生物
細胞生物學、遺傳學、生態學與生命科學基礎。
-
which invention was most important in revolutionizing the meat industry…
# Breve explicación: El refrigerador car permitió el transporte de carne fresca a largas distancias, revolucionando la industria de la carne al evitar la spoilage y expandir el me…
-
classify the following types of evidence: serial number, soil sample, t…
Serial Number: Physical Soil Sample: Physical TikTok: Neither (it's digital) Pollen: Biological
-
multiple - choice question biotic factors are nonliving true false
False
-
ecology is the study of a habitat false true
False
-
having excellent grades in math and science means that a person may be …
For the first question: B. Engineering For the second question: A. Artisan
-
question 10 of 10 the sharecropping system: a. kept freed black america…
A. kept freed Black Americans landless and trapped in debt.
-
proteins that are able to (speed up) the rate of a chemical reaction.
enzimas; catalizar
-
13 fill in the blank 5.25 points was the name of the program suggested …
"Share Our Wealth"
-
4.1 ecosystem changes (day 1 - 1) 1. what factors can cause an ecosyste…
1. Climate change; rising temperatures can alter habitats. 2. Through secondary succession with pioneer species colonizing first. 3. Allows species co - existence and proper funct…
-
which character from the ramayana is an incarnation of the god vishnu? …
A. Rama
-
read the passage. then, select the synonym of the word in bold. located…
fickle
-
2 multiple choice 10 points according to the gel electrophoresis result…
D. Suspect B
-
evidence is any small but measurable amounts of physical or biological …
Trace
-
9 multiple choice 10 points which is the best example of how transgenic…
9. producing rice that contains vitamin A 10. genetically identical to the original organism
-
multiple choice 10 points which is a step in the process of producing t…
7. D. A human gene is inserted into a bacterial plasmid. 8. C. gene therapy
-
6 multiple choice 10 points what type of biotechnology is being shown b…
D. Recombinant DNA technology
-
4 multiple choice 10 points a genetically modified organism (gmo) or tr…
4. C. An organism that contains DNA from another organism or foreign DNA 5. D. to increase the nutritional value of rice.
-
question 7 of 10 how did employment opportunities expand for women duri…
A. Women gained access to jobs they had been denied before the war.
-
according to the gel electrophoresis results, which suspect left dna at…
1. D. Suspect B 2. A. Modifying DNA by adding or removing genes
-
multiple choice 10 points which of the following best explains why dna …
C. Each individual has a unique DNA sequence, with the exception of identical twins
-
question 7 of 10 what was one result of the confederate victory at the …
B. The victory boosted the Confederate army's confidence.
-
summarize: answer the following questions in the space provided. attemp…
1. The text does not provide information on who built bonfires to celebrate Samhain. 2. The text does not provide information on what connects a bat's fingers together. 3. The tex…
-
question 3 of 10 robert e. lee launched his invasion of maryland in ord…
B. lower morale and reduce support for the war in the North.
-
world history b (15341) industrial production crashed during the cultur…
the Red Guards imprisoned important leaders.
-
reading comprehension & more: select the choice that answers the questi…
1. d. Bats have become a major part of the Halloween tradition for many reasons. 2. d. They have always been symbols of darkness since they can only be seen at night. 3. c. many a…
-
what is the meaning of the word assiduous as used in the passage? film …
# Breve explicación: En el contexto del texto, se dice que los directores fueron "asiduos" en su compromiso con la precisión, y se refiere a su búsqueda diligente del realismo. La…
-
kanna keeps excellent records and always knows precisely how much is in…
Check her records against her bank statement
-
read the passage. then, select the synonym of the word in bold. film di…
Diligent
-
water rising 1 polara paced along the ramparts, striving to stay alert.…
# Breve explicación: En los párrafos, se menciona que Polara camina por los remates y trata de mantenerse alerta, lo que implica su deber de vigilar. Además, está respirando el ai…
-
is a molecule that carries energy inside cells and serves as the energy…
1. ATP 2. Chloroplast 3. Chlorophyll 4. Light - dependent reactions 5. ADP 6. Electron transport chain 7. Light - independent reactions 8. Stroma 9. ATP 10. Photosystem I 11. Phot…
-
multiple choice: select the choice that completes the statement or answ…
1. d. flying 2. b. six feet 3. c. insects 4. a. Samhain 5. b. Halloween 6. wings 7. reflect 8. are active 9. darkness 10. light
-
analyzing diction it is much safer to be feared than loved.... among th…
inhuman, cruelty, rebelled
-
it is much safer to be feared than loved.... among the wonderful deeds …
by using a historical event to prove the claim
-
it is much safer to be feared than loved.... among the wonderful deeds …
Anecdotal
-
vocabulary american revolution handout read/respond (#1 - 10) 1. who wo…
1. The British won the Seven - Years' War. They gained large North - American territories like Canada and land east of the Mississippi River. 2. The Tea Act was passed by Parliame…
-
question 27 of 30 which of the following is a disadvantage of planting …
A. It can decrease farming efficiency and profit.
-
question. select the correct text in the passage. read this excerpt fro…
"While I nodded, nearly napping, suddenly there came a tapping" and "As of some one gently rapping, rapping at my chamber door" and "Only this and nothing more"
-
1. fill in the complementary dna strand by using the dna base pairing r…
Complementary DNA: TACCATCGATTGGAA mRNA: AUGGUAUCGAUUGGAA Amino - acids: Methionine, Valine, Serine, Isoleucine, Glycine tRNA: UACCAUAGCUAAUCCUU
-
question 19 of 30 which kind of society is using a sustainable method o…
A. One that obtains renewable resources locally
-
question 17 of 30 human activities, including the use of fossil fuels, …
B. They could agree upon limits for emissions of environmentally damaging substances.
-
question 16 of 30 where would carbon dioxide sequestration technology b…
B. At a factory that burns fossil fuels
-
1. why did pennsylvania move its capital from philadelphia to harrisbur…
1. Pennsylvania moved its capital from Philadelphia to Harrisburg in part due to the central location of Harrisburg for better governance and to reduce the dominance of Philadelph…
-
question 14 of 30 as monoculture becomes more profitable, some crop var…
C. Creating an international seed bank to protect biodiversity
-
the image illustrates one method of sustainable development: a building…
D. To capture carbon dioxide released from other activities
-
question 11 of 30 what is the goal of using sustainable practices in fo…
C. To feed a growing population without harming ecosystems or public health
-
original dna sequence: tacaccttggcgacgact mrna sequence: auguggaaggcugc…
Mutated DNA sequence #5 mRNA sequence: AUGUGGAAUCCUGCUGA Mutated DNA sequence #5 amino - acid sequence: Met - Trp - Asn - Pro - Cys - stop Likely effects: Shorter protein, likely …
-
a sea otter is a mammal with the thickest fur. it can have 943,725 hair…
$9\times10^{5}$
-
question 23 of 25 which of these is a drawback of the endangered specie…
A. It costs a lot of money to enforce.
-
original dna sequence: tacaccttggcgacgact mrna sequence: amino acid seq…
Original mRNA: AUGUGGAACCGCUGCUGA Original amino - acid sequence: Met - Trp - Asn - Arg - Cys - Stop Normal hemoglobin mRNA: GUGCACCUUGACCUCCUGAGG Normal hemoglobin amino - acid s…
-
question 21 of 25 which of these is a main goal of cites? a. to keep fl…
C. To protect species from unsustainable trade practices
-
question 19 of 25 how would you expect a species survival plan to affec…
C. It would lead to the successful reintroduction of crested toads into the wild.
-
question 17 of 25 which of these is a shortcoming of the convention on …
A. It does not cover bacteria, fungi, or protists.
-
question 16 of 25 which of these is the main goal of a species survival…
C. Reintroducing endangered species to the wild
-
question 28 of 28 how are the characteristics of imperialism and revolu…
D. The political revolutions in some regions were caused by foreign oppression under imperialist systems.
-
question 26 of 28 which european country experienced a revolution that …
C. France
-
read the passage below written by dr. james mccune smith, an american a…
C. The belief that a person is inferior because of race is false.
-
question 24 of 28 which of the following describes the relationship bet…
A. The revolutions showed that it was possible for colonists to succeed in revolting against European monarchs.
-
question 11 of 25 which sentence best states a limitation of the treaty…
B. It does not address the loss of habitat.
-
question 22 of 28 which statement describes the abolition movement in t…
A. Though the United States eventually abolished slavery, fierce regional disagreements about the system kept it in place throughout much of the century.
-
exercise causes many factors of negative feedback to jump start into ac…
The human body uses negative - feedback mechanisms like adjusting pulse rate, sweating, breathing and heart rate to maintain homeostasis during exercise.
-
question 19 of 28 in what way did the economic causes of the american a…
B. While American colonists objected to paying taxes without having a voice in government, the French revolutionaries fought against a tax system that produced extreme poverty.
-
question 8 of 25 which of these is the primary goal of the convention o…
C. Sustainable development
-
question 18 of 28 which of the following best describes the importance …
B. The U.S. government is limited in the types of laws it can pass.
-
the second industrial revolution in the united states lasted from the e…
B. end of the Civil War to 1900.
-
which of these is a main goal of the international treaty on plant gene…
C. To protect farmers' rights to benefit from plant genetic resources
-
question 5 blood clotting when a part of the body is injured, it releas…
The stimulus was decreased.
-
question 10 of 28 which of the following was one of toussaint louvertur…
D. He led the Haitian independence movement and ended slavery on the island.
-
1. every time you eat, a negative - feedback mechanism controls the lev…
This is a negative feedback loop.
-
question 7 of 28 which of the following was a consequence of the haitia…
D. The government banned slave labor and racial discrimination.
-
question 6 of 28 read the following passage written by charles de monte…
A. Separation of powers
-
question 5 of 28 which of the following was a consequence of the napole…
B. Many conquered countries adopted legal systems based on the idea that laws should be publicly known and fairly implemented.
-
all endotherms regulate their temperature. endotherms are animals that …
The stimulus decreased.
-
question 4 of 28 which of the following best describes a motivation for…
A. To exploit natural resources
-
question 3 of 28 which of the following best defines the concept of a r…
D. An attempt to end the rule of a government and replace it with a new one
-
question 2 of 28 in 1848, groups in sicily, france, germany, italy, and…
C. Revolution
-
question 1 of 28 how did the consequences of the american and french re…
C. The French Revolution led to a change of government, but the American Revolution led to the formation of a new country.
-
question 24 of 24 how did the industrial revolution affect social life …
C. The creation of new jobs resulted in new social stratifications for the middle and working classes.
-
question 22 of 24 which economic activity spread throughout europe duri…
A. Governments let business owners set rules concerning working conditions.
-
question 20 of 24 which of the following was a common experience for wo…
C. Operating machinery in a factory
-
question 19 of 24 how did the scientific revolution contribute to the e…
D. Discoveries that led scientists to challenge church traditions inspired philosophers to question the traditional authority of monarchs as well.
-
the declaration of independence wasn’t just written for king george iii…
Jefferson wanted international support, legitimacy, and to showcase the justice of the American cause based on universal human - rights principles, potentially gaining allies and …
-
question 17 of 24 how did agricultural surpluses contribute to the indu…
A. A decrease in the demand for farm laborers forced many farming families to move to cities.
-
question 15 of 24 how did the scientific revolution change europe? a. n…
A. New theories undermined the strength of the church and led people to question authority in general.
-
question 28 of 34 which of these is an effect of habitat fragmentation?…
B. Reduced habitat patch size
-
question 14 of 24 which of the following beliefs is most characteristic…
D. Humanity can be improved through rational change.
-
in 2003, the total population was 290,810,789, with 143,037,790 males a…
30.53
-
question 13 of 24 how did the industrial revolution affect european soc…
A. Before the Industrial Revolution, European industries relied on manual labor to produce goods, but afterward, they began relying on machines.
-
question 12 of 24 why was isaac newtons mathematical principles of natu…
C. Its explanations of motion and gravity helped prove the theories of earlier scientists like Galileo.
-
question 11 of 24 which of the following historical events directly con…
D. The independence granted to European universities
-
question 9 of 24 how did the development of the steam engine lead to ma…
A. People were able to travel more easily to remote parts of the world.
-
question 8 of 24 which of the following factors contributed to the rise…
B. The practice of capitalism led to many well - paying jobs that didn't depend on manual labor.
-
question 7 of 24 why were james watts improvements to the steam engine …
A. His improvements made it possible to use the steam engine for transportation and manufacturing.
-
question 3 of 24 look at the map of the world. which country experience…
C. Country B
-
question 2 2 pts why is maintaining homeostasis important to living thi…
They must keep their internal environment within a narrow range of conditions to survive.
-
protein synthesis worksheet place the correct term into the illustratio…
From top to bottom, left to right in the boxes (assuming the general flow of the diagram): - Above the DNA in the nucleus box: Nuclear membrane - Next to the arrow from DNA to mRN…
-
world history b (15341) collapse of communism quiz complete 1 2 3 4 5 6…
Czechoslovakia's split into two countries
-
which was a main reason for creating the articles of confederation? ○ t…
To determine the power of states and the federal government
-
we hold elections to elect representatives. the alternative would be a …
D. direct democracy
-
based on the data, scientists claim that kelp forests are more biodiver…
Of the 98 species found significantly more often in forested habitats, 25 were found only in forested areas.
-
3 multiple choice 1 point which document confirmed the rights of englis…
D. English Bill of Rights