Question

original dna sequence: tacaccttggcgacgact
mrna sequence: auguggaaggcugcuga
amino acid sequence: met - trp - asn - arg - cys - stop
mutated dna sequence #5: tacaccttggggacgact
what will be the corresponding mrna sequence?
what will be the amino acid sequence?
will there likely be effects?
what kind of mutation is this?

1. do all substitution mutations lead to a change in the amino acid sequence (consider what you know about codons) - explain.
2. what could potentially cause more damage (or greater benefit) to an organism - a substitution mutation or a frameshift (insertion/deletion) mutation? explain your reasoning.

sickle cell anemia
sickle cell anemia is the result of a type of mutation in the gene that codes for part of the hemoglobin molecule. hemoglobin is a protein that carries oxygen in your red blood cells. the sickle cell anemia mutation causes red blood cells to become stiff and sickle - shaped when they release their oxygen. the sickled cells tend to get stuck in blood vessels, causing pain and increased risk of stroke, blindness, and damage to the heart and lungs.
analyze the dna strands below to determine what amino acid is changed and what type of mutation occurred.
normal hemoglobin dna: cacgtggactgaggactcctc
normal hemoglobin mrna:
normal hemoglobin aa sequence:
sickle cell hemoglobin dna: cacgtggactgaggacacctc
sickle cell hemoglobin mrna:
sickle cell hemoglobin aa sequence:

Explanation:

Step1: Transcribe DNA to mRNA

For the DNA sequence TACACCTTGGGACGACT, during transcription, A pairs with U, T pairs with A, G pairs with C and C pairs with G. So the mRNA sequence is AUGUGGAAUCCUGCUGA.

Step2: Translate mRNA to amino - acid sequence

Using the genetic code, AUG codes for Methionine (Met), UGG for Tryptophan (Trp), AAU for Asparagine (Asn), CCU for Proline (Pro), UGC for Cysteine (Cys), UGA is a stop codon. So the amino - acid sequence is Met - Trp - Asn - Pro - Cys - stop.

Step3: Analyze potential effects

Since the mutation shortens the DNA sequence and thus the resulting protein will be shorter than normal, this can likely have significant effects on protein function as it may lack important functional domains.

Step4: Identify mutation type

The original DNA sequence is TACACCTTGGGACGACT and the mutated one is TACACCTT. This is a deletion mutation as nucleotides (GGGACGACT) are removed from the original DNA sequence.

For the sickle - cell anemia part:

Step5: Transcribe normal hemoglobin DNA to mRNA

The normal hemoglobin DNA is CACGTGGACTGAGGACTCCTC. Transcribing it gives GUGCACCUUGACUCCUGAGGAG.

Step6: Translate normal hemoglobin mRNA to amino - acid sequence

GUG codes for Valine (Val), CAC for Histidine (His), CUU for Leucine (Leu), GAC for Aspartic acid (Asp), UCC for Serine (Ser), UGA is a stop codon (but not in this part of the sequence yet), GAG for Glutamic acid (Glu), GAG for Glutamic acid (Glu). So part of the sequence is Val - His - Leu - Asp - Ser - Glu - Glu.

Step7: Transcribe sickle - cell hemoglobin DNA to mRNA

The sickle - cell hemoglobin DNA is CACGTGGACTGAGGACACCTC. Transcribing it gives GUGCACCUUGACUCCUGUGGAG.

Step8: Translate sickle - cell hemoglobin mRNA to amino - acid sequence

GUG for Valine (Val), CAC for Histidine (His), CUU for Leucine (Leu), GAC for Aspartic acid (Asp), UCC for Serine (Ser), UGU for Cysteine (Cys), GGA for Glycine (Gly), GAG for Glutamic acid (Glu).
The amino - acid that is changed is Glutamic acid (Glu) to Valine (Val) in the sickle - cell version. This is a substitution mutation as a single nucleotide change (from A to T in the DNA) causes a change in the amino - acid.

Answer:

Mutated DNA sequence #5 mRNA sequence: AUGUGGAAUCCUGCUGA
Mutated DNA sequence #5 amino - acid sequence: Met - Trp - Asn - Pro - Cys - stop
Likely effects: Shorter protein, likely non - functional or malfunctioning due to truncation
Mutation type: Deletion mutation
Normal hemoglobin mRNA: GUGCACCUUGACUCCUGAGGAG
Normal hemoglobin AA sequence: Val - His - Leu - Asp - Ser - Glu - Glu
Sickle cell hemoglobin mRNA: GUGCACCUUGACUCCUGUGGAG
Sickle cell hemoglobin AA sequence: Val - His - Leu - Asp - Ser - Cys - Gly - Glu
Amino acid changed: Glu to Val
Mutation type in sickle - cell: Substitution mutation