Question

original dna sequence: tacaccttggcgacgact
mrna sequence:
amino acid sequence:
mutated dna sequence #5: tacaccttggacgact
what will be the corresponding mrna sequence?
what will be the amino acid sequence?
will there likely be effects? what kind of mutation is this?

1. do all substitution mutations lead to a change in the amino acid sequence (consider what you know about codons)-explain
2. what could potentially cause more damage (or greater benefit) to an organism - a substitution mutation or a frameshift (insertion/deletion) mutation? explain your reasoning.

sickle cell anemia
sickle cell anemia is the result of a type of mutation in the gene that codes for part of the hemoglobin molecule. hemoglobin is a protein that carries oxygen in your red blood cells. the sickle cell anemia mutation causes red blood cells to become stiff and sickle - shaped when they release their oxygen. the sickled cells tend to get stuck in blood vessels, causing pain and increased risk of stroke, blindness, and damage to the heart and lungs.
analyze the dna strands below to determine what amino acid is changed and what type of mutation occurred.
normal hemoglobin dna cacgtggactgaggactcctc
normal hemoglobin mrna
normal hemoglobin a.a. sequence
sickle cell hemoglobin dna cacgtggactgaggacacctc
sickle cell hemoglobin mrna
sickle cell hemoglobin a.a. sequence

Explanation:

Step1: Transcribe original DNA to mRNA

In transcription, A pairs with U, T with A, G with C and C with G. Original DNA: TACACCTTGGCGACGACT. mRNA: AUGUGGAACCGCUGCUGA

Step2: Translate mRNA to amino - acid sequence

Using the genetic code, AUG = Methionine (Met), UGG = Tryptophan (Trp), AAC = Asparagine (Asn), CGC = Arginine (Arg), UGC = Cysteine (Cys), UGA = Stop codon. Amino - acid sequence: Met - Trp - Asn - Arg - Cys - Stop

Step3: Analyze mutated DNA (assuming no mutation given yet, but for general process)

If mutated DNA is TACACCTTGGCGACGACT (same as original here for now), mRNA is still AUGUGGAACCGCUGCUGA and amino - acid sequence is Met - Trp - Asn - Arg - Cys - Stop. If there was a substitution mutation, for example, if the DNA was TACACCTTGGCGACGACT and it mutated to TACACCTTGGCGACGAT, mRNA would be AUGUGGAACCGCUGCUA.

Step4: Determine amino - acid change in case of mutation

The new amino - acid sequence with the above mutation: AUG = Met, UGG = Trp, AAC = Asn, CGC = Arg, UGC = Cys, UAA = Stop. The change depends on the specific mutation.

Step5: Analyze sickle - cell anemia DNA

Normal hemoglobin DNA: CACGTGGACTGAGGACTCCTC. mRNA: GUGCACCUUGACCUCCUGAGG. Amino - acid sequence: Val - His - Leu - Asp - Pro - Leu - Glu. Sickle cell hemoglobin DNA: CACGTGGACTGAGGACACCTC. mRNA: GUGCACCUUGACCUCCUGUGG. Amino - acid sequence: Val - His - Leu - Asp - Pro - Leu - Val. The mutation is a substitution (A to T in DNA), changing Glu to Val in the amino - acid sequence.

Step6: Answer question 1

Not all substitution mutations lead to a change in the amino - acid sequence. This is because of the degeneracy of the genetic code, where multiple codons can code for the same amino - acid. For example, UCU, UCC, UCA, and UCG all code for Serine. So, a substitution within these codons may not change the amino - acid.

Step7: Answer question 2

Frameshift (insertion/deletion) mutations are generally more damaging. In a frameshift mutation, the reading frame of the codons is shifted. Since codons are read in groups of three nucleotides, an insertion or deletion of a non - multiple of three nucleotides will change all subsequent codons and thus all subsequent amino - acids in the polypeptide chain. In substitution mutations, only one codon is affected, and it may or may not change the amino - acid.

Answer:

Original mRNA: AUGUGGAACCGCUGCUGA
Original amino - acid sequence: Met - Trp - Asn - Arg - Cys - Stop
Normal hemoglobin mRNA: GUGCACCUUGACCUCCUGAGG
Normal hemoglobin amino - acid sequence: Val - His - Leu - Asp - Pro - Leu - Glu
Sickle cell hemoglobin mRNA: GUGCACCUUGACCUCCUGUGG
Sickle cell hemoglobin amino - acid sequence: Val - His - Leu - Asp - Pro - Leu - Val