Biologie
Zellbiologie, Genetik, Ökologie und Grundlagen der Lebenswissenschaften.
-
a consumer is an organism that a. is not a predator. b. cannot store it…
D. gets matter and energy by eating other organisms as food.
-
question 3 do either of your diseases in part a have the same pattern o…
To answer this, we first recall that colorblindness (typically red - green colorblindness) is an X - linked recessive trait. For a disease from part A to have the same inheritance…
-
select the correct mrna sequence for this gene (dna): you might need to…
a. AUGACGGC AUCACCCG CAAUUGGCGACAUAAACAAG
-
question 24 select the correct mrna sequence for this gene (dna): you m…
a. AUGACGGCATCACCCGCA AUUGGCGACAUAA CAAG (Note: Assuming the option a is correctly written as AUGACGGCATCACCCGCA AUUGGCGACAUAA CAAG, which is the mRNA sequence obtained by replaci…
-
match the dna --> mrna nitrogenous base sequence: column a \t\t\t\t\tco…
1. a. mRNA gets an A 2. b. mRNA gets a G 3. d. mRNA gets a C 4. c. mRNA gets a U
-
question 2 in part a, you analyzed genes that contribute to two disease…
Scientists can develop new treatments by targeting the proteins encoded by disease - associated genes (e.g., with small - molecule inhibitors), using gene therapy to correct fault…
-
where does translation occur? a in a mitochondrion b at a ribosome c in…
b. at a ribosome ### Question 2 (What gets produced at the end of translation?):
-
question 18 what is transcription? a the attachment of trna to amino ac…
b. the process of making an mRNA "copy" of a gene ### Question 19
-
column a 1. a dna a. z 2. b mrna b. q 3. c ribosome c. x 4 d protein d.…
1. a. DNA - d. Y 2. b. mRNA - a. Z 3. c. Ribosome - b. Q 4. d. Protein - c. X
-
40 the division of bacterial cells into two new cells is called: * spor…
C. Binary Fission
-
part b: analyzing data question 1 why do you think scientists track the…
Scientists track genes of rats/mice as they are model organisms with genetic similarities to humans, aiding in understanding human gene functions and disease mechanisms. Rat genes…
-
search the nih gene database for the term colorblindness. use the resul…
To explain how a non - colorblind father ($X^{B}Y$) and a non - colorblind (carrier, $X^{B}X^{b}$) mother can have a colorblind son: ### 1. Gene Basis (from NIH Database) Color bl…
-
which statement best describes how scientists use anatomical features t…
D. Similar bone structure in a hand, wing, or foot could mean that a fossilized organism and a modern organism are related
-
which organisms are more closely related? the great white shark and the…
A. The great white shark and the megalodon
-
which statement does not accurately compare the megalodon to the modern…
The killer whale and the megalodon share similar characteristics in their teeth pattern, skeletal structure, and method for obtaining oxygen.
-
based on the anatomical features of the embryos, which pairs of organis…
B. Pig and Human D. Tortoise and Chicken
-
in the early stages the embryos are dropdown each other. as time progre…
1. most similar to 2. become more different from 3. fish (or other distantly related organisms like reptile, amphibian etc.)
-
an outcome of which revolution(s) resulted in conflict and a temporary …
D. the French Revolution
-
a political effect of the enlightenment was that some monarchs embraced…
A. some monarchs embraced new ideas from the movement.
-
inheritance—whether the disease is dominant or recessive—using this sum…
To complete this task, we need to know the specific details of the diseases and their associated genes (such as gene names, chromosome locations, whether they are on sex chromosom…
-
which two factions disagreed on the french revolution’s path? ○ the lib…
A. the Liberals and the Conservatives
-
how did the telescope help make the scientific revolution possible? ○ i…
C. It allowed scientists to observe objects in space in much greater detail.
-
what was so \glorious\ about the glorious revolution? ○ it set a preced…
A. It set a precedent for monarchs sharing power with Parliament.
-
which list states achievements from the scientific revolution in the co…
i. The heliocentric theory is published. ii. The scientific method is developed. iii. Galileo argues for Copernicus. iv. Isaac Newton develops calculus. (The option with this orde…
-
amidst ongoing famine, rising discontent, and increased taxes louis xvi…
D. to attempt economic and monetary crisis reform
-
what role did the working class of france play during the reign of terr…
B. They strongly supported the Jacobins' use of radical measures.
-
a goal of which revolution(s) was the restoration of a protestant monar…
D. the Glorious Revolution
-
the english bill of rights laid the foundation for the glorious revolut…
D. a constitutional monarchy
-
what factors influenced the goal of the american revolution? choose thr…
B. The Glorious Revolution, C. The English Bill of Rights, D. The Enlightenment
-
how did the enlightenment idea of separation of powers influence the ef…
C. Americans established power in legislative, executive, and judicial branches of government.
-
which revolutions were caused by a reaction to absolute authority? ○ th…
the French, American, and Glorious revolutions
-
unfair taxation was a cause in which revolutions? the glorious and fren…
D. the American and French revolutions (Note: Assuming the last option is D; if options are labeled differently, adjust the identifier. The text of the correct option is "the Amer…
-
the desire for the glorious revolution came from englands response to t…
B. James II
-
activity (continued from previous page) 3. define: a phase change is a …
Evaporation: Change from a liquid to a gas. Condensation: Change from a gas to a liquid. Melting: Change from a solid to a liquid. Freezing: Change from a liquid to a solid.
-
a goal of the glorious revolution was ○ to protect a catholic monarchy.…
B. to protect Parliament’s power.
-
an outcome of which revolution(s) resulted in conflict and a temporary …
D. the French Revolution
-
the french revolution grew more violent mainly because radicals reacted…
C. rumors of foreign intervention to end the revolution.
-
what impact did the french revolution have on the rest of europe? ○ oth…
C. Other European countries declared war on France.
-
what was the major reason radicals were so angry? ○ europe wanted to pu…
A. Europe wanted to put Louis XVI back in power.
-
the timeline shows major changes in russias history between 1910 and 19…
A. World War I
-
under lenin, some of the leaders of the communist government privately …
A. privately disagreed with the direction of the revolution.
-
which best describes lenins new economic policy, established in 1921? ○…
B. It temporarily allowed some private ownership of land in the Soviet Union.
-
what happened to the tsar during the russian revolution? ○ he regained …
C. He was executed.
-
describing the reign of terror use the drop-down menus to complete the …
was accused of treason and executed
-
use the drop-down menus to complete the sentences. the sans - culottes …
The first drop - down (for the committee Robespierre led) answer: Committee of Public Safety
-
use the drop-down menus to complete the sentences. the sans - culottes …
radical and violent
-
what does speed refer to? the ability to perform a movement or cover a …
the ability to perform a movement or cover a distance in a short amount of time
-
the lictors bring to brutus the bodies of his sons, jacques - louis dav…
C. It demonstrated the importance of loyalty to one's country.
-
which of the following best describes endurance runners? those who run …
B. those who run at a slower speed but for a longer duration (assuming the options are labeled A, B, C with A being "those who run at a slow pace and rest frequently", B being "th…
-
which of the following refers to the ability to perform a movement or c…
C. speed (assuming the options are labeled A, B, C as endurance, flexibility, speed respectively)
-
who runs fast over a short distance? endurance runners sprinters marath…
B. sprinters (assuming the options are labeled as A. endurance runners, B. sprinters, C. marathon runners)
-
which of the following is not mentioned as a basic movement pattern? ro…
A. rolling
-
what is the significance of adding sprinting to movement patterns? it r…
A. It requires coordination and quick decision - making.
-
which of the following best describes lateral movement? moving sideways…
A. moving sideways
-
in photosynthesis, carbon dioxide (co₂) and water (h₂o) combine to form…
12 oxygen atoms (the option with "12 oxygen atoms")
-
activity c (continued from previous page) 3. analyze: examine the resul…
Monosaccharides, amino acids, water - soluble vitamins, minerals, and some short - chain fatty acids. #### B
-
we stand for organized terror – this should be frankly admitted. terror…
B. Soviet citizens had few rights when accused of a crime.
-
urination is one of the key mechanisms for losing fluid from the human …
T
-
besides urination, the other methods for fluid loss from the body are _…
A. perspiration and respiration
-
why is it important to understand the vulnerability of the nervous syst…
A. to emphasize the need for preventive measures, prompt diagnosis, and effective treatment to protect
-
what is the significance of the spine in body functions? the spine play…
B. The spine serves as the main pathway for communication between the brain and the rest of the body.
-
how does the brainstem contribute to sensory perception? acting as a br…
A. acting as a bridge for relaying sensory information from the body to the brain
-
how many types of neurotransmitters are involved in brain communication…
A. Multiple types of neurotransmitters are involved in brain communication.
-
which part of the nervous system serves as the central command center, …
B. the brain (assuming the options are labeled as A. the spinal cord, B. the brain, C. the muscles for clarity; original options are the spinal cord, the brain, the muscles, so th…
-
2. complete the following statement with the correct claim and reasonin…
D. photosynthesis because the sediment blocks light energy needed by underwater plants to produce food.
-
which part of the nervous system is primarily affected by polio? white …
B. motor neurons in the spinal cord
-
which of the following acts as the main pathway for the brain and the r…
B. the spine
-
what is the primary function of the cranial nerves? connecting the brai…
A. connecting the brain to various parts of the head and neck
-
what is the function of neuromuscular junctions? to orchestrate the inv…
C. to enable the transmission of nerve impulses to elicit muscle contractions
-
what connects the brain to the peripheral nerves and acts as a communic…
A. the spinal cord
-
homework questions 1. which structures could most likely be observed in…
(1) cell walls and chloroplasts ### Question 2
-
rossword puzzle date across a knitted garment typically with long sleev…
To solve the crossword puzzle, we match each clue with the appropriate word from the word bank: ### Across Clues: 1. *A knitted garment typically with long sleeves, worn over the …
-
pick up sticks \think of bones like solid sticks or struts. think of mu…
the covering around the muscles (the option with this text)
-
question 4 of 10 which technology would be best in managing a patient’s…
A. Glucose meter
-
1. which sentence is best expanded for meaning? (1 point) my favorite r…
My favorite restaurant is downtown.
-
select which four scenarios require you to provide care before you call…
The four scenarios that require providing care before calling for help are: - [X] You're at a restaurant when you notice someone at the next table drop their cutlery and grasp at …
-
question 8 (mandatory) (1 point) which of the following is an example o…
A. Weight lifting
-
question 13 (mandatory) (1 point) how does resistance training prevent …
The correct option is: It increases bone mass, making your bones stronger and denser
-
question 10 (mandatory) (1 point) what is cardiorespiratory endurance? …
The ability of your heart and lungs to work during prolonged exercise
-
question 2 (mandatory) (1 point) which kind of tumor grows slowly and i…
Benign (the option corresponding to "Benign" among the radio buttons)
-
read the passage from sugar changed the world. a stream of pale ash - c…
D. "Over and over again the liquid had to be strained and purified." (Note: Assuming the options are labeled A - D as per typical multiple - choice, with the last option being D. …
-
in this theory of muscle growth, muscle fibers are able to split and cr…
B. hyperplasia
-
partial biomass pyramid for a particular marine ecosystem shrimp ? kg z…
C. 200 kg
-
question 14 (1 point) a brief, involuntary facial expression shown on t…
c. microexpression
-
6. utilizando la evidencia proporcionada, construya una explicación que…
La selección natural ha promovido adaptaciones en yaks de la siguiente manera: - **Variación**: Existe diversidad genética en la población (ej: grosor de pelaje, eficacia digestiv…
-
3.1 matching 2 points match the vip to their accomplishment napoleon bo…
- Napoleon Bonaparte - French military leader who led many campaigns during the Revolution - Simon Bolivar - A wealthy Venezuelan creole, known as "The Liberator" - Toussaint Louv…
-
4. a barnacle lives on a whale. the whale is not harmed, and the barnac…
This is commensalism. The barnacle benefits by getting a habitat, transportation, and access to food particles from the whale's movement, while the whale is neither harmed nor ben…
-
according to source 8, what was a major cause of the global spread of h…
D. Land bridges (assuming the options are labeled A - D with D being Land bridges; if the original labeling was different, adjust the identifier, but based on the options, the cor…
-
ii. directions: place a plus (+) in the space provided if the statement…
### Part II (True/False with + for true, 0 for false) 11. When performing CPR on an infant, the correct method is to cover both the mouth and nose with your mouth (not just the mo…
-
question 5 (1 point) what principle states that when two objects come i…
c. Locard’s Exchange Principle
-
35. which statement best describes how viruses disrupt normal cellular …
The correct option is the one with the statement: "Viruses use cell machinery to build products the virus needs." (Assuming this is, for example, the third option in the list of r…
-
which process results in greater genetic diversity in offspring? recomb…
The correct option is "recombination of DNA during meiosis" (the option with the radio button selected in the image, representing the process that results in greater genetic diver…
-
otra función del riñón es ayudar a regular la cantidad de glóbulos rojo…
La evidencia es: - Los grupos expuestos a **poco oxígeno** (ocho ciclos de 4 minutos o 120 minutos continuos) tienen **niveles de EPO mayores** que el grupo con exposición normal …
-
34. which process results in greater genetic diversity in offspring? op…
recombination of DNA during meiosis
-
why would sheltering in place under one of these desks be a poor choice…
The computer’s could fall
-
q1 multiple choice 1 point what is a best(lan)? ○ text that covers film…
A. text that covers film (assuming this is the correct option based on the context, though the question is a bit unclear) ### Q2 (Multiple Choice)
-
11. which of the following correctly describes how the light-dependent …
The light - dependent reactions produce ATP and NADPH needed for the Calvin Cycle. (The option with this description)
-
10. the calvin cycle takes place in which part of the chloroplast? * th…
C. Stroma
-
9. the oxygen released during photosynthesis comes directly from the sp…
A. Water
-
directions: type your answer in the box. a researcher sequenced an mrna…
AGT CCT