Question

select the correct mrna sequence for this gene (dna):
you might need to write out the mrna on paper first, before you select your answer.
(image of dna helix, chromosome, and dna sequence with options a, b, c, d:)

a augacggc a ucacccgcaauuggcgacauaacaag
b uacugccguagugggcguuaaccgcuguauuguiuc
c augacggcactacccgcuattggc a acattacgag
d atgacggcatcacccgcaattggcgacat a acaag

Explanation:

Step1: Identify the DNA template strand

The DNA strand used for transcription (template strand) here is the one with the sequence: \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \) (we'll use the non - red - boxed complementary strand? Wait, no, actually, in DNA, the coding strand and template strand are complementary. Wait, the given DNA gene sequence (the non - red - boxed upper strand? Wait, the red - boxed is maybe the template? Wait, no, let's recall: during transcription, the DNA template strand is used, and mRNA is synthesized by base - pairing: A (DNA) pairs with U (mRNA), T (DNA) pairs with A (mRNA), G (DNA) pairs with C (mRNA), C (DNA) pairs with G (mRNA).

Wait, looking at the DNA sequence: the upper non - red - boxed strand is \( \text{ATGACGGATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \), and the red - boxed lower strand is \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \). Wait, actually, the template strand for transcription is the one that is complementary to the coding strand. But maybe the gene is the upper strand? Wait, no, let's take the DNA sequence that is being transcribed. Wait, the problem says "this gene (DNA)", so let's look at the DNA sequence. Let's take the sequence: Let's assume the DNA sequence (the coding strand or the template? Wait, no, the mRNA is transcribed from the template strand, which is complementary to the coding strand. But maybe the given DNA sequence (the one that is the gene) is the upper strand: \( \text{ATGACGGATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \)? Wait, no, the red - boxed is the lower strand. Wait, maybe the DNA sequence for the gene is \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \) (the red - boxed one). Wait, no, let's check the options. Option d is a DNA sequence (has T), so it's not mRNA. Option b has U but let's check base - pairing.

Wait, let's take the DNA template strand. Let's assume the DNA template strand sequence is \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \) (we'll correct the spacing). Let's write the DNA template strand sequence: \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \) → let's make it continuous: \( \text{TACTGCGTAGTCGGCGTT CGGCTTAACCGCGTATTGTT C} \) (maybe a typo in the original, but let's proceed).

Now, transcribe it to mRNA:

For each base in the DNA template strand:

- T (DNA) → A (mRNA)
- A (DNA) → U (mRNA)
- C (DNA) → G (mRNA)
- G (DNA) → C (mRNA)

Let's take the DNA sequence from the gene (let's look at the upper non - red - boxed strand: \( \text{ATGACGGATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \)? Wait, no, the options:

Option a: \( \text{AUGACGGC A UCACCCG CAAUUGGCGACAUAAACAAG} \) (let's correct the spacing: \( \text{AUGACGGC AUCACCCG CAAUUGGCGACAUAAACAAG} \))

Option b: \( \text{UACUGCCGUAGUGGGC CGUUAACCGCUGUAUUGUUC} \)

Option c: \( \text{AUGACGGCACTACCCG CUATTGGC AACATTACGAG} \)

Option d: \( \text{ATGACGGCATCACC CGC AATTGGCGACATAAACAAG} \) (DNA, so eliminate d)

Now, let's take the DNA sequence (the coding strand or the template). Wait, the correct way is: the DNA has a coding strand and a template strand. The coding strand has the same sequence as the mRNA (except T is U). Wait, no: the coding strand (also called the non - template strand) has the same sequence as the mRNA, with T replaced by U. The template strand is complementary to the coding strand.

Looking at the upper non - red - boxed DNA sequence: \( \text{ATGACGGATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \). If we replace T with U, we get \( \text{AUGACGGAUCAGCCG CAAGCGGAAUUGGCGACAUAAGAAG} \), but the options don't have this. Wait, maybe the DNA sequence is the red - boxed one: \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \). Let's transcribe this to mRNA:

T (DNA) → U? No, wait: during transcription, the template strand is used, and the base - pairing is:

DNA template: A - U (mRNA), T - A (mRNA), G - C (mRNA), C - G (mRNA)

So if the DNA template strand is \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \)

Let's break it down:

T → A

A → U

C → G

T → A

G → C

C → G

G → C

T → A

A → U

G → C

T → A

C → G

G → C

G → C

C → G

G → C

T → A

T → A

C → G

G → C

C → G

T → A

T → A

A → U

A → U

C → G

C → G

G → C

G → C

T → A

A → U

T → A

T → A

G → C

T → A

T → A

G → C

T → A

C → G

Wait, this is getting messy. Let's look at the options. Option a: \( \text{AUGACGGC AUCACCCG CAAUUGGCGACAUAAACAAG} \)

Let's check the base - pairing with the DNA sequence. Let's take the DNA sequence (coding strand) as \( \text{ATGACGGATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \). If we have a typo in the DNA sequence (maybe the original DNA has \( \text{ATGACGGCATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \) → wait, the option a has \( \text{AUGACGGC AUCACCCG CAAUUGGCGACAUAAACAAG} \). Wait, maybe the DNA sequence is \( \text{ATGACGGCATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \), and when we transcribe it (replace T with U, and maybe some base changes? No, wait, no: the mRNA is transcribed from the template strand, which is complementary to the coding strand. So if the coding strand is \( \text{ATGACGGCATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \), the template strand is \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \), and the mRNA will be complementary to the template strand, so same as the coding strand but with T replaced by U.

So coding strand: \( \text{ATGACGGCATCAGCCG CAAGCGGAATTGGCGACATAAGAAG} \)

mRNA: replace T with U: \( \text{AUGACGGC AUCAGCCG CAAGCGGAAUUGGCGACAUAAGAAG} \), but option a is \( \text{AUGACGGC AUCACCCG CAAUUGGCGACAUAAACAAG} \). Wait, maybe the DNA sequence has some differences. Wait, the option a has "CACCCG" instead of "CAGCCG", maybe a typo in the DNA. Alternatively, let's check the options again.

Option d is DNA (has T), so eliminate. Option c has T (no, option c: \( \text{AUGACGGCACTACCCG CUATTGGC AACATTACGAG} \) – no, mRNA has U, but there's a T? No, option c has "CUATTGGC" – no, mRNA can't have T. Wait, no, option c: \( \text{AUGACGGCACTACCCG CUATTGGC AACATTACGAG} \) – the "T" here is a mistake? No, maybe I misread. Wait, no, mRNA has U, so option c has a T? No, "CUATTGGC" – "T" is in the mRNA? No, that's wrong. So option c is invalid. Option b: \( \text{UACUGCCGUAGUGGGC CGUUAACCGCUGUAUUGUUC} \) – this is complementary to a DNA sequence, but not the one we expect. Option a: \( \text{AUGACGGC AUCACCCG CAAUUGGCGACAUAAACAAG} \) – let's check the base - pairing. If the DNA template strand has T, A, C, G, then:

For option a:

A (mRNA) ← T (DNA)

U (mRNA) ← A (DNA)

G (mRNA) ← C (DNA)

A (mRNA) ← T (DNA)

C (DNA) → G (mRNA)? Wait, no, let's take the first few bases of option a: AUGACGGC...

AUG corresponds to TAC in DNA (since A - T, U - A, G - C? Wait, no: mRNA is synthesized from DNA template strand. So DNA template: TAC → mRNA AUG (because T - A, A - U, C - G? Wait, no: DNA template base T pairs with A in mRNA, A in DNA template pairs with U in mRNA, C in DNA template pairs with G in mRNA, G in DNA template pairs with C in mRNA.

So if the DNA template strand starts with TAC, mRNA starts with AUG.

Looking at option a: starts with AUG. Let's check the next bases. The DNA template strand for the first part: TAC (DNA) → AUG (mRNA), TGC (DNA) → ACG (mRNA), GTA (DNA) → CAU (mRNA), GTC (DNA) → CAG (mRNA)? Wait, no, option a has "AUGACGGC AUCACCCG..."

Wait, maybe the DNA sequence is \( \text{TACTGCGTAGTCGGGC GTT CGGCTTAACCGCGTATTGTT C} \), and when we transcribe it:

T (DNA) → A (mRNA)

A (DNA) → U (mRNA)

C (DNA) → G (mRNA)

T (DNA) → A (mRNA)

G (DNA) → C (mRNA)

C (DNA) → G (mRNA)

G (DNA) → C (mRNA)

T (DNA) → A (mRNA)

A (DNA) → U (mRNA)

G (DNA) → C (mRNA)

T (DNA) → A (mRNA)

C (DNA) → G (mRNA)

G (DNA) → C (mRNA)

G (DNA) → C (mRNA)

C (DNA) → G (mRNA)

G (DNA) → C (mRNA)

T (DNA) → A (mRNA)

T (DNA) → A (mRNA)

C (DNA) → G (mRNA)

G (DNA) → C (mRNA)

C (DNA) → G (mRNA)

T (DNA) → A (mRNA)

T (DNA) → A (mRNA)

A (DNA) → U (mRNA)

A (DNA) → U (mRNA)

C (DNA) → G (mRNA)

C (DNA) → G (mRNA)

G (DNA) → C (mRNA)

G (DNA) → C (mRNA)

T (DNA) → A (mRNA)

A (DNA) → U (mRNA)

T (DNA) → A (mRNA)

T (DNA) → A (mRNA)

G (DNA) → C (mRNA)

T (DNA) → A (mRNA)

T (DNA) → A (mRNA)

G (DNA) → C (mRNA)

T (DNA) → A (mRNA)

C (DNA) → G (mRNA)

This is too time - consuming. Let's recall that mRNA has U instead of T, and is complementary to the DNA template strand. Option d is DNA (has T), so eliminate. Option c has a T (so it's not mRNA), eliminate. Option b: the sequence is complementary to a DNA sequence, but the start is UAC, which would be transcribed from a DNA template starting with ATG, but our DNA gene starts with TAC (if the template is TAC...), so mRNA should start with AUG. Option a starts with AUG, which is correct for a DNA template starting with TAC. So the correct option is a.

Step1: Eliminate non - mRNA options

Options with T (DNA nucleotides) are not mRNA. Option d has T, so eliminate d. Option c has a T in the mRNA sequence (invalid, as mRNA has U), so eliminate c.

Step2: Check base - pairing and start codon

mRNA is transcribed from the DNA template strand. The start codon for mRNA is usually AUG, which is complementary to TAC in the DNA template strand. Option a starts with AUG, which is consistent with transcription from a DNA template starting with TAC. Option b starts with UAC, which would be complementary to ATG in DNA, not the expected start for a gene (as genes usually start with a sequence that transcribes to AUG). So option a is the correct mRNA sequence.

Answer:

a. AUGACGGC AUCACCCG CAAUUGGCGACAUAAACAAG