生物
细胞生物学、遗传学、生态学与生命科学基础。
-
17. select the environment most likely to encourage the fossilization o…
Relatively shallow ocean
-
16. why is the presence of oxygen considered \bad\ for the fossilizatio…
Oxygen is essential for the metabolic processes of aerobic bacteria and decomposers that break down organic matter.
-
in a group of syrian hamsters, some individuals have short fur and othe…
- "Marzipan's phenotype for the fur length gene is \(Ff\)" should be corrected to "Marzipan's genotype for the fur length gene is \(Ff\)". - "Marzipan's genotype for the fur lengt…
-
15. preservation bias refers to the fact that paleontologists only coll…
the fossil record showing organisms that had a better chance of becoming fossils because of their body type and location.
-
in a group of guinea pigs, some individuals have brown eyes and others …
- Click on \(EE\) and change it to \(ee\). - Click on \(brown\ eyes\) and change it to \(red\ eyes\). - Click on \(heterozygous\) and change it to \(homozygous\).
-
13. select the methods of fossilization from the list pre - mineralizat…
Mineralization, casts and molds, Preserved in amber, desiccation
-
in a group of muskmelon plants, some individuals have sour fruit and ot…
- Change "phenotype" to "genotype". - Change "heterozygous" to "homozygous". - Change "genotype" to "phenotype" and "sweet fruit" to "sour fruit".
-
13. select the methods of fossilization from the list pre - mineralizat…
Mineralization, casts and molds, Preserved in amber, desiccation
-
this passage describes the coat graying trait in horses: your hair may …
- Change “phenotype” to “genotype” and “\(Gg\)” to “\(GG\)” in “Rudolph's phenotype for the coat graying gene is \(Gg\)”. - Change “heterozygous” to “homozygous” in “Rudolph is he…
-
task #2 directions: below you will find a list of statements that descr…
G, H, B, D, C, I, F, A, E, J
-
what are antioxidants? benefits of antioxidants antioxidants are substa…
1. - Heart disease - Macular degeneration - Diabetes (or cancer) 2. - 5 - 25 3. - Vitamin A (Carrots) - Vitamin E (Vegetable oil) - Vitamin C (Strawberries) - Vitamin C (Broccoli)…
-
a cell with a water potential of -1.5 bars is placed in a beaker of sug…
Out of the cell
-
18 chemosynthesis is a cellular process used by organisms in deep sea e…
A. Chemosynthesis harvests energy from other chemical compounds.
-
due to the current pandemic, many people are using more hand sanitizer …
Bacteria may develop increased resistance to the hand - sanitizer over time due to natural selection acting on bacteria with inherent tolerance to the sanitizer's active ingredien…
-
according to karl marx, the economic ideas behind socialism would lead …
communist revolution.
-
which punnett square shows the results of a cross between two organisms…
B
-
if the \stronger\ bacteria survive, and therefore are the only ones lef…
DNA ; Trait
-
of the united states. i think thats the comparison thats the comparison…
A. There were no laws or rules holding the U.S. to higher standards of treatment towards Japanese - Americans.
-
if the normal, non - mutated bacteria are killed by the antibiotics, wh…
The mutated, resistant bacteria
-
in general, which best explains why communist revolutions did not happe…
Capitalist governments enacted reforms.
-
which statement best describes africa immediately after the end of worl…
B. Many African nations demanded that colonial governments grant them their independence.
-
punnett square practice complete the punnett squares below about mendel…
Yellow seed - \(100\)%, Green seed - \(0\)%, Round seed - \(50\)%, Wrinkled seed - \(50\)%, Tall plant - \(100\)%, Short plant - \(0\)%, Homozygous Dom (\(P - p\)) - \(25\)%, Hete…
-
hardness is another physical property of minerals. the harder a mineral…
D. 2
-
complete the paragraph with the correct forms of verbs in the list. som…
Madame Arnaud **travaille** au lycée. Elle **enseigne** le français. Elle **explique** les verbes et la grammaire aux élèves. Le vendredi, en classe, les élèves **regardent** une …
-
if you retold the tornado scene from totos point of view, what skill wo…
Using perspective to create a new narrative voice
-
cerebral white matter what is the name of the white matter structure th…
Corpus callosum
-
brain ventricles the lateral ventricles are connected to the third vent…
Interventricular foramina
-
which lines from the poem facing it best communicate the authors intern…
I said I wouldn't, dammit. No tears. I'm stone. I'm flesh (lines 3 - 5)
-
receptors of the parasympathetic nervous system what type of receptor i…
Muscarinic receptor
-
1 multiple choice 20 points a material is biodegradable if it is made o…
1. it can be broken down by biological processes. 2. can open or limit possibilities of future generations.
-
read the passage. romare bearden revolutionized american art through hi…
Given that Empress of the Blues blends consistent elements with unexpected changes, Bearden likely valued art that balances familiar patterns with striking deviations.
-
global pop superstar zara lux was suing the daily reveal for reporting …
It mocks the exaggerated importance Zara places on her own voice.
-
to the board members of the lakewood estates homeowners association: it…
Language like "weighty, if peculiar, responsibility" and "compass of my heart" suggest that the author enjoys framing his unusual traditions as formal and respectable.
-
internal waves can be formed by differences in water... density tempera…
All of the first three options (density, temperature, salinity) are correct as temperature and salinity differences lead to density differences which form internal waves. But if i…
-
which event in earths history most directly allowed life to exist on la…
Single - celled organisms released oxygen into the air when they photosynthesized.
-
the perils of indifference by elie wiesel, pages 246 - 250 mr. presiden…
1. The rage of the American soldiers at what they saw and their compassion. 2. For what she said and for what she was doing for children in the world, for the homeless, for the vi…
-
question 7 of 10 which of the following is a characteristic of diving d…
D. They get a running start on the water to take flight
-
what is a characteristic that all songbirds share in florida? a they al…
D. They are all protected and cannot be hunted
-
read the excerpt from \children of the drug wars.\ by sending these chi…
"handing them a death sentence"
-
tâche 3 : laigle marc, un ornithelogue, étudie la trajectoire dun aigle…
\(212\) secondes
-
match the word with its definition apotheosis archetype eboon incarnate…
apotheosis - the highest state of development or ability archetype - a typical example of something, or the original model of something from which others are copied boon - an adva…
-
before you read after you read this section, you should be able to answ…
It carries oxygen and nutrients to your cells. It carries wastes away from your cells.
-
23. the commanding general of the confederate army was 24. the union ge…
23. Robert E. Lee 24. Ulysses S. Grant 25. Thomas J. "Stonewall" Jackson 26. Atlanta; Savannah 27. Fort Sumter 28. Antietam 29. Vicksburg 30. supply; re - election 31. high; turni…
-
fermentation and anaerobic respiration are the same thing. true false r…
B. False
-
aerobic respiration happens when... there is no oxygen there is oxygen …
B. there is oxygen
-
which of the following are products for cellular respiration? (choose 3…
ATP, Water, Carbon Dioxide
-
how are the things needed for cellular respiration transported to the c…
Through the blood stream
-
breathing is the same as cellular respiration. true false rewatch next …
B. False
-
what led to closer economic ties between the united states and south af…
After the repeal of segregation laws, the United States lifted economic trade and contributed funding to essential industries.
-
carters foreign policy listen provide the word or words that correctly …
Tehran
-
omnipotence and eternal existence are divine activities of god. true fa…
False
-
2) select all that apply. 2) what were three implications of social dar…
- **First question**: - It supported the idea that White people were better equipped to handle wealth and power. - It reinforced the need to prohibit interracial dating and marria…
-
6) choose the best answer. why is race a social construct? race is clos…
6. It is subjective, defying scientific certainty and has varied over the years and varied based on the state or country. 7. race
-
the acquisition of territories such as puerto rico and the philippines …
A. A commitment to spreading democracy
-
in what way did the industrial revolution in the u.s. show the success …
By driving technological innovation and increasing production efficiency
-
in what way did the industrial revolution in the u.s. show the success …
By driving technological innovation and increasing production efficiency
-
the acquisition of territories such as puerto rico and the philippines …
D. A commitment to spreading democracy
-
what is an energy pyramid? a model that represents all the feeding rela…
A model that shows specifically how energy moves through living things.
-
when energy is transferred between living things, how much of the origi…
90 percent
-
living things interact in ways that increase their chances of what? out…
D. All of these
-
what is a food web? a model that shows specifically how energy moves th…
A model that represents all the feeding relationships within a community of organisms.
-
what does the shape of an energy pyramid represent?the decreasing amoun…
The decreasing amount of energy available at each level of the pyramid
-
what is the relationship between adaptations and competition? adaptatio…
Adaptations help organisms compete for resources.
-
use the diagram to type in answers for the following questions: what ar…
- What are the reactants of photosynthesis? \(6CO_2\) (carbon dioxide) and \(6H_2O\) (water). - What are the products of photosynthesis? \(C_6H_{12}O_6\) (glucose) and \(6O_2\) (o…
-
give some other examples of heterotrophs. give some other examples of a…
Examples of autotrophs: plants (e.g., sunflowers), algae (e.g., green algae in ponds), cyanobacteria. Examples of heterotrophs: animals (e.g., dogs, cows), fungi (e.g., bread mold…
-
due no due date points 30 submitting an external tool immediately after…
Business managers are responsible primarily to stockholders, so management must be concerned with providing a return on owners' investments.
-
no due date points 30 submitting an external tool which of the followin…
False and misleading advertising is both illegal and unethical.
-
rishaan just researched the bernard madoff scandal, and he is appalled …
Business ethics
-
simplify. 1.) 2.) 3.) 4.) step 1. it should not have been separated the…
Step 2. \(\cos\theta\) and \(\sin\theta\) are reversed in the first fraction.
-
exponential equations 59pm points 100 submitting an external tool curre…
\(x = 96.0\)
-
submitting an external toolial equation. $3^{2x - 3}=5^{4x + 5}$places …
$-2.675$
-
4. a close, interdependent relationship between two organisms is called…
Symbiosis, Mutualism, Parasitism, Commensalism
-
3. every species of fig has its own species of fig wasp to pollinate it…
C. Mutualism
-
normal ladybug: cggacactgctctcccaagagtatcagtacctctttagaagacctgaattcattc…
75%
-
2. given the discussion thus far of commensalism and parasitism, would …
Yes, parasitism is an accurate way to describe the relationship between the strangler fig and the cypress tree.
-
analyzing the narrators perspective the more i think about my parents s…
The narrator's harsh internal dialogue helps the reader understand her struggles.
-
which statement is true regarding lipoprotein lipase? o a. thin people …
d. Fat cells in women's breasts, hips, and thighs are especially abundant in lipoprotein lipase.
-
1. as a seeding, the strangler fig and host tree have a relationship th…
Commensalism is a good description because the strangler fig seedling benefits (gets support to access sunlight) and the host tree is not (yet) harmed or helped.
-
select the passage that has a more melodramatic tone. oh, this journey!…
The first passage (Oh, this journey! It was two hours cut clean out of his life, two hours in which he might have done so much, so much - written the perfect poem, for example, or…
-
d. in tomatoes, red fruit (r) is dominant to yellow fruit (r). cross a …
1. \( 2 \) 2. \( 2 \) 3. \( 50\%\) 4. \( 50\%\) 5. \( 1:1\) (red : yellow) 6. \( 1:1\) (\( Rr:rr \))
-
comprehension read the statements below. if the statement is true, writ…
1. F. Organic tomatoes may have health benefits (e.g., lower pesticide residues). 2. F. Consumers pay approximately 20 - 100% more for organic food than conventional food. 3. T. 4…
-
c. in humans, oval - shaped eyes (a) are dominant to round - shaped eye…
1. \( 1 \) 2. \( 1 \) 3. \( 100\% \) 4. \( 0\% \) 5. Oval - shaped 6. Round - shaped 7. \( 1:0 \) (all oval) 8. \( 1:0 \) (all \( Aa \))
-
b. in rabbits, the allele for black coat (b) is dominant over the allel…
1. \( 2 \) 2. \( 1 \) 3. \( 100\%\) 4. \( 0\%\) 5. Black
-
a. in laboratory mice, gray coat color (g) is dominant over albino coat…
1. \(2\) 2. \(2\) 3. \(50\%\) 4. \(50\%\) 5. Gray 6. Albino 7. \(1:1\)
-
select all the true statements about how plants use and change energy. …
- Photosynthesis transforms light energy into chemical energy. - Plant cells use cellular respiration to get chemical energy from food. - Chlorophyll captures light energy.
-
unit 1: free write questions: use your knowledge from this unit to help…
One environmental benefit is the reduction of greenhouse gas emissions as EVs produce zero tailpipe emissions (which can be from renewable electricity sources). Another is the red…
-
question 6 (1 point) which of the following is used as an alternative t…
C. Intensive probation parole supervision
-
multiple - choice question mitochondria release energy, or atp, through…
Respiration
-
multiple - choice question which organelle is responsible for packaging…
Golgi Apparatus
-
cells: the grand cell tour golgi apparatus multiple - choice question s…
Liver
-
what potential harm can warm stormwater runoff from heat islands cause?…
It harms water quality in nearby areas.
-
multiple - choice question what is attached to the rough er to make it …
Ribosomes
-
multiple - choice question what is the main function of the endoplasmic…
Transporting molecules around the cell
-
multiple-choice question what is created by the nucleolus? proteins rib…
Ribosomes
-
multiple - choice question the nucleus of the eukaryotic cell is import…
it contains DNA & controls the cell
-
introduction to cells: the grand cell tour amoeba sisters ribosomes wha…
Amino acids.
-
1. recall what you learned about the scientific method. what would be a…
Plants produce a substance (like oxygen) that allows animals to survive and candles to continue burning.
-
what word is used to describe how the cell membrane lets certain things…
Semi - permeable
-
fix any words that are used incorrectly. if there are no errors, submit…
The great white shark is the world's largest predatory fish, but its reputation as a ferocious killer is undeserved. These sharks rarely hunt humans, and they're highly intelligen…
-
fix the one word that is used incorrectly. \plastic water bottles can b…
Change "there" to "they are".