Question

dna mutation simulation
access the simulation at: lab interactive: dna to protein (connected bio)

1. identify the parts of the model:

b ribosome
a amino acids
c trna
d mrna

1. what is the role of mrna in this process?
2. click on enter or edit dna and copy this code:

atgccaggcggcgagagctaa

Explanation:

mRNA (messenger RNA) is synthesized from DNA during transcription. It carries the genetic code (sequence of nucleotides) from the DNA in the nucleus to the ribosomes in the cytoplasm. At the ribosomes, the mRNA sequence is translated into a sequence of amino acids (a protein) according to the genetic code. So, its role is to serve as a template for protein synthesis, carrying the genetic information from DNA to the ribosome.

Answer:

mRNA serves as a template for protein synthesis, carrying the genetic information from DNA to the ribosome.