生物
細胞生物學、遺傳學、生態學與生命科學基礎。
-
question 6 (0.5 points) listen which structure insulates axons and spee…
Myelin
-
which part of the neuron receives incoming signals? myelin nucleolus de…
Dendrite
-
select the correct answer from each drop - down menu. mina has the flu …
First dropdown: second Second dropdown: innate
-
question 4 (0.5 points) listen what failure in neurulation leads to neu…
Open ends of the neural tube not closing
-
which neural crest cells form the pharyngeal arches? cardiac neural cre…
Cranial neural crest cells
-
which primary vesicle remains as the midbrain in the adult? mesencephal…
Mesencephalon
-
question 1 (0.5 points) what is the time span of the embryonic period? …
0-8 weeks
-
directions respond to the following warm - up prompt with a 100 - word …
Some traits with a broad range of phenotypes include human skin color, height, and eye color. These traits arise from polygenic inheritance, where multiple genes contribute additi…
-
drag the tiles to the boxes to form correct pairs. match the diseases w…
- Reproductive system (female): Endometriosis - Respiratory system: Pneumonia - Integumentary system: Dermatitis - Muscular system: Fibromyalgia
-
the balkan powder keg explodes 5. synthesize why did austria-hungary an…
1. **Question 5**: Austria-Hungary and Germany went to war against Serbia for three key reasons: - Nationalism: Serbian Pan-Slavism threatened Austria-Hungary's multi-ethnic state…
-
type the correct answer in the box. spell all words correctly. fill in …
effector
-
when an insect touches the bristles on the lobes of a venus flytrap, th…
C. predation
-
read the sentence. rome has been called the eternal city for centuries …
B. utopian and monopoly
-
4 how do molecules in a gas compare to those in a solid? a molecules in…
A. Molecules in a solid have a fixed structure, while molecules in a gas spread out
-
theres a roughly linear relationship between the length of someones fem…
The femur length for someone with an expected height of 130 centimeters.
-
2 multiple choice 4 points which of the following does not describe nat…
D. They always have an animal as the main character.
-
describe the structure and function of the circulatory system multiple …
### Multiple Choice Answers (with explanations for each): #### 1. What functions as the pump of the circulatory system? - **Explanation**: The heart is the muscular organ that pum…
-
question 6 1 pts what is a major factor that limits the number of troph…
C. amount of energy
-
2. a botanist discovers a new plant species in the amazon rainforest th…
1. Question 2: The plant's leaf pigments reflect blue wavelengths of visible light, and absorb non-blue wavelengths (such as red, orange, yellow, and green) to use for photosynthe…
-
question 4 at what levels of life do ecologists work? choose all that a…
Population, Ecosystem, Organism, Community ### Question 5
-
question 2 1 pts what is the definition of ecology? the study of intera…
B. The study of interactions of living organisms with one another and their environment. ### Question 3
-
you are given the task to write an alternate ending to \its only fair\.…
C. After they argue, Maritza convinces Avery, and they write about both Rosa Parks and Irene Morgan.
-
passage 1 passage 2 a new dream monday, october 10, 1927 i am so excite…
to demonstrate the importance of talkie films
-
3 how can you add energy to water? type draw speak enter answer here...
You can add energy to water by: 1. Heating it (e.g., using a burner, solar heat) to transfer thermal energy, increasing its temperature or causing phase changes like boiling. 2. A…
-
5 of 5 using the word bank, label the species. note: to complete this q…
Top left image: American Badger Top middle image: Opossum Top right image: Pronghorn Bottom left image: Moose Bottom middle image: White-tailed Deer Bottom right image: Nine-bande…
-
2 what is a property of liquids? a liquid molecules are arranged in a s…
B. Liquids have no fixed shape
-
text structures quick check \day we discovered cause of white death\ by…
B. Epidemics are caused by specific microbes.
-
10. which statement would nicole agree with? 〇 riding in a tank is like…
D. School is a challenge. With help, she won’t be derailed. (Note: Assuming the options are labeled A - D as per typical multiple - choice formatting, with D corresponding to "Sch…
-
8. at the end of the book, nicole wants to share good news. what does s…
D. She will get a new prosthetic leg.
-
7. shane said hi to nicole. nicole scowled at him. that means nicole ○ …
B. made an angry face. (Note: Assuming the second option is labeled B, as per typical multiple - choice formatting where the second option here is "made an angry face". If the ori…
-
which line of code uses the correct syntax to apply an external css sty…
D. `<link rel="stylesheet" type="text/css" href="syb/syb.css"/>`
-
1 describe how water can be a liquid, solid, and gas.
Water exists as three states based on temperature/pressure and molecular behavior: 1. **Solid (Ice)**: At ≤0°C (standard pressure), H₂O molecules form a rigid, ordered crystalline…
-
crocodiles, lizards, and snakes are all reptiles. however, lizards are …
C. Lizards and snakes are more alike since both species have a recent common ancestor.
-
charles darwin was credited for writing the biological theory of ______…
C. evolution by natural selection, Galapagos finches
-
on a scale of 1-4, how confident are you about the functions of the cel…
This is a self - assessment question. One would choose an option (1 - 4) based on their actual confidence level. For example, if a student feels very confident, they would choose …
-
analyze the cellular composition of a heart muscle cell versus a fat st…
D. Because heart cells have a constant high energy demand for contraction, which mitochondria supply via ATP. (assuming the last option is D; if the options were labeled A - D wit…
-
a certain toxin destroys the centrioles within a cell. what is the most…
B. The cell will be unable to divide to create new cells.
-
describe the correct pathway for a protein that is destined to be secre…
A. Ribosome on Rough ER -> Golgi Apparatus -> Vesicle -> Cell Membrane
-
side-splotched lizards, uta stansburiana, are a type of lizard found in…
B. when the color morphs can no longer breed with each other
-
what is the key difference in the primary function of lysosomes versus …
Lysosomes digest waste and old organelles, while peroxisomes neutralize specific toxic compounds. (The teal - colored option, assuming the full option is as described in the expla…
-
which of these provides structural support for a plant cell, and is not…
C. Cell Wall
-
the bones in the front limbs of many mammals are similar in their struc…
D. homologous structures
-
which organelle is primarily responsible for breaking down damaged orga…
A. Lysosome
-
name:_______________________________period:_________ word bank simile, …
Onomatopoeia; sound 2.
-
which statement correctly compares mitochondria and chloroplasts? chlor…
D. Both are involved in energy conversion and contain their own DNA.
-
according to darwins theory of evolution, which organisms are best able…
D. organisms that possess overall characteristics best suited to their environment
-
what is the main role of the golgi apparatus? breaking down waste mater…
Modifying, sorting, and packaging proteins and lipids for delivery.
-
a cell that produces large amounts of steroid hormones would likely hav…
B. Smooth ER
-
what is the primary function of the nucleolus? to store the cells dna. …
D. To act as a factory for producing ribosomes. (Note: Assuming the options are labeled A - D with A being the first (yellow), B the second (blue), C the third (orange), D the fou…
-
what is the primary function of the nucleolus? to store the cells dna. …
The correct option (assuming the last option is "To act as a factory for producing ribosomes") is the fourth option: To act as a factory for producing ribosomes.
-
what is the primary difference between cytoplasm and cytosol? cytosol i…
A. Cytosol is the fluid part of the cytoplasm, which also includes the organelles.
-
how do passages 1 and 2 use the same evidence to develop opposing argum…
Passage 1 uses MRI scans to show that stimulus produced by the brain proves that love is a biological concept. Passage 2 uses MRI scans to show that the same area of the brain pro…
-
passage 2: romantic love is a fairy tale 1 some people truly believe th…
These studies are not reliable; even many scientists are skeptical about their results.
-
evaluate the historical significance of shays rebellion in shaping the …
D. It convinced leaders to create a new constitution with a stronger federal government
-
in what order do the electrons move through the electron transport chai…
b) Water - photosystem II - photosystem I - NADPH
-
where is the light energy converted into an electron flow? a) within th…
d) In the reaction center chlorophyll
-
where does the light reaction of photosynthesis take place? a) in the c…
d) In the thylakoid membrane
-
read the following excerpt from passage 1, paragraph 8: jo boaler, math…
It supports the argument that shifting toward problem - solving instruction can help students find an alternative way to learn math.
-
5. the double helix model of dna explained chargaffs rules because a. a…
A. adenine could hydrogen-bond with thymine and guanine could hydrogen-bond with cytosine to hold the helix together.
-
analyzing dna structure 4. watson and crick made a successful model of …
C. a double helix with bases inside the helix.
-
3. an important clue to the structure of dna was provided by a. a prote…
B. an X-ray diffraction photograph of DNA.
-
which of the following is the correct definition of photosynthesis? a) …
b) The process used by organisms to convert light energy to chemical energy
-
directions: for the following experiments, identify the independent var…
a. Independent Variable: Type of fertilizer (or application of fertilizer, including no fertilizer) b. Dependent Variable: Number of flowers on each bush c. Control Variable: Type…
-
analyzing dna structure 2. rosalind franklin used what technique in her…
D. X-ray diffraction
-
in our class examples, where did the arduino get its power from? a simu…
A. A simulated USB connection
-
analyzing dna structure 1. chargaffs experiments in dna analysis were c…
A. The percentages of adenine (A) and thymine (T) were always equal.
-
amoeba sisters video recap: classification 1. first things first! some …
1. Similarity: Both are living cell types. Differences: Prokaryotes have no nucleus/membrane-bound organelles; eukaryotes have a nucleus and organelles. (Left = Prokaryote, Right …
-
where does the electron flow that we measure with dcpip originate? a) p…
a) Photosystem II
-
ive heard that our principals predecessor, or the person in that job be…
b. Your great - great - grandparents.
-
multiple choice dna replication occurs with the help of several molecul…
B. enzymes
-
multiple choice what is the complementary strand for gattgc? a agttcg b…
C. CTAACG
-
match each word to its definition. material that carries information ab…
1. material that carries information about how an organism will look and function → e. DNA 2. a protein that acts as a catalyst in an organism → b. enzyme 3. small molecule used t…
-
world history | north murray high school conquest graphic organizer | |…
To fill in the "Conquest Graphic Organizer" for the remaining explorers, we analyze each: ### Bartholomew Diaz - **Country of Origin**: Portugal (born in Portugal, part of Portugu…
-
on the other side of the dig site, a fern fossil is visible in sandston…
C. The area must have had soil, sunlight, and rain 70 million years ago
-
10. people with heartburn often take antacids, medicines that lower the…
10. Yes, antacids can affect digestion, primarily by impairing protein breakdown: - Stomach acid activates pepsinogen to pepsin (the main protein-digesting enzyme); reduced acidit…
-
practice: transcribing and translating transcribe and translate the fol…
mRNA: AUGGCCUACGGUCUAGUUUAG amino acids: Met, Ala, Tyr, Gly, Leu, Val, Stop ### Problem 2:
-
reproductive isolation worksheet use the options below to identify whic…
Type of Reproductive Isolation: Geographic Isolation
-
12 the diploid number of a cell is 16. what is its haploid number? 13 t…
1. 8 2. 18 3. Gametes are haploid (have one set of chromosomes, used for sexual reproduction), while most other animal cells are diploid (have two paired sets of chromosomes, func…
-
what can rock layers tell us about earths history? what comes to mind w…
Rock layers are a tangible record of Earth's deep history: they preserve fossilized remains of long-extinct species that reveal the evolution of life, chemical and isotopic compos…
-
if you look under a microscope and see distinct chromosomes in a cell, …
No, the cell is not in interphase. In interphase, genetic material is in the form of uncondensed chromatin, not distinct, visible chromosomes; condensed chromosomes only appear du…
-
there is no scientific consensus on why we yawn. one theory argues that…
the exact scientific reason for yawning
-
d. nucleosomes. protein synthesis is occurring in a ribosome. is this a…
Translation
-
use the information from the table to answer the question. greek roots …
kinesiology
-
chromosomes inside the nucleus that are paired with others of similar s…
a. homologs.
-
the roman empire, han dynasty, and gupta empire all followed a similar …
### Similar Empire Pattern - Each formed when several **independent** regions united. - Each thrived for **hundreds** of years. - Each fell due to a combination of outside **invad…
-
geology is the study of earths rocks, landforms, history, and the force…
- Processes that form rocks and minerals - The structure of Earth's layers - Past climates and life forms
-
a dna strand has the following sequence of nucleotides: t-a-c-g-c-a-a-t…
a. $A-U-G-C-G-U-U-A-C-G-G-U-U-A-A$ b. 5 c. 4 amino acids: Methionine, Arginine, Tyrosine, Glycine
-
e. mitosis what is one disorder in the body where some cells no longer …
d. cancer
-
during the cell cycle, when is dna replicated? a. $g_1$ b. s c. $g_2$ d…
b. S
-
2 in nucleic acids dna and rna, the backbone is made up of a. nitrogeno…
c. sugars and phosphates.
-
4. watch the biointeractive short film the making of the fittest: natur…
To solve this, we follow these steps: ### Step 1: Watch the Film View *The Making of the Fittest: Natural Selection and Adaptation* to gather information on mouse fur color, natur…
-
name: directions: use the clues below to fill in the crossword puzzle. …
To solve the crossword puzzle, we analyze each clue: ### ACROSS Clues: 1. **Animals without eyes, mouth, or organs**: Likely a simple organism like *sponge* (but check length; the…
-
which situation is an example of competition that could be found in the…
B. two lion populations utilize the same gazelle population as their main food source
-
which choice is likely to result in the most competition? organisms tha…
organisms that use the same resource
-
which organism provides energy to all other organisms in this ecosystem…
prairie grass
-
which item is an example of a producer? sun fern chestnut ant
○ fern
-
what is a key element found in all carbohydrates, lipids, proteins, and…
carbon
-
which place describes a community? the desert a forest of birds, insect…
a forest of birds, insects, and squirrels
-
which choice is an abiotic factor of an ecosystem? ants minerals dogs f…
B. minerals
-
which action is a response to external stimuli? eating when hungry wear…
B. wearing sunglasses to protect eyes from UV rays