生物
細胞生物學、遺傳學、生態學與生命科學基礎。
-
4) choose the best answer. ____ found in every cell and makes up 70% of…
4) Water is 5) A mineral
-
3) choose the best answer. this nutrient makes the lipid layer in cell …
D. fat
-
1) choose the best answer. the bodys preferred way to get energy comes …
1. carbohydrate 2. protein
-
read the paragraph. devin slept soundly, dreaming of his baseball tourn…
A. Devin will sleep through his alarm.
-
7.3 costs in the short run due wednesday by 11:59pm points 100 submitti…
$66.96$
-
10. describe the structure and function of the nucleus. what distinguis…
11. Ribosomes are small particles, free - floating or attached to RER. Free ones are scattered in cytoplasm, attached ones make RER look rough. 12. Mitochondria are rod - shaped w…
-
7.3 costs in the short run due wednesday by 11:59pm points 100 submitti…
C. the money an employee spends on transportation
-
initial observation: as part of this laboratory, you will participate i…
Type of observation this is: Qualitative 1. Qualitative: - Definition: Observations that describe qualities or characteristics of a subject without using numbers. - Example Senten…
-
4. a woman with a weight 500 n sits on the floor. assuming that there a…
500 N
-
3. you are a biochemist working for a food manufacturer. you are workin…
An unsaturated fat.
-
generations the populations of mimics is dominate by the more extreme p…
Disruptive selection results in greater genetic variation because it favors extreme phenotypes, splitting the population and increasing the range of genetic traits present.
-
8. what do starch, glycogen, and cellulose all have in common in terms …
They are all polysaccharides composed of glucose monomers.
-
experiment 3: analyze the graphs now show the rates of protease, carboh…
Protease: Low Lipase: Low Carbohydrase: Low
-
6. complete the following table regarding monosaccharides and polysacch…
| | Starch | Glucose | Cellulose | Glycogen | |--|--|--|--|--| | Identify as a monomer or polymer | Polymer | Monomer | Polymer | Polymer | | Describe the function | Energy storag…
-
read the following text from a journal. this excerpt is about captain r…
Scott and his men were saddened.
-
8. a cell’s membrane consists, in large part, of a molecule called a “p…
A phospholipid both loves and fears water. Its head is hydrophilic and loves water, while its tails are hydrophobic and fear water.
-
which is the best way to complete the text? polar bears have translucen…
sunlight; this
-
7.1 explicit and implicit costs and accounting and economic profit due …
B. explicit
-
multiple choice 1 point the national governments ability to create the …
D. Implied Powers
-
32. which of the following is true of spinal cord injuries? * residents…
32. The higher the injury, the greater the loss of function. 33. Lymph 34. Sitting upright
-
some flatworms reproduce through fragmentation. what is a disadvantage …
It is a process that leads to lower genetic diversity than sexual reproduction.
-
7.1 explicit and implicit costs and accounting and economic profit due …
False
-
7.1 explicit and implicit costs and accounting and economic profit due …
False
-
which process would lead to offspring with the exact same genetic infor…
C. A bacterium splitting in two
-
20. which of following is a function of the circulatory system? it sens…
20. It supplies food, oxygen and hormones to cells 21. Inspiration and expiration 22. Regular exercise
-
a successful biologists main interest area would be _. please select th…
B. scientific
-
scenario #2 a student observes that petunias potted in terrafirm brand …
Based on the experiment, petunias seem to grow better in Terrafirm soil as the plant in Terrafirm soil had the greatest height (3.5 inches) compared to the others.
-
read the following text from a historical novel. this excerpt is about …
It shows Sorrel doubting a report from Harrison.
-
1 multiple choice 1 point the mitochondria is the: congress the preside…
D. Powerhouse of the cell
-
many fungi, algae and some plants reproduce asexually by producing a re…
D. creating spores
-
11. guidelines for caring for a resident with multiple sclerosis includ…
11. Preventing falls 12. None of the above (as the provided options are incorrect) 13. The muscle decreases in size
-
asexual reproduction strategies quick check in which form of reproducti…
A. fragmentation
-
which would be the best way of describing the overall structure of thor…
He moves from a consideration of his surroundings to an evaluation of the state as a whole.
-
10) true or false: most of the loyalists stayed in the united states af…
B. FALSE
-
in civil disobedience, what is thoreaus last thought about the state be…
He thinks the state can't tell its friends from its enemies.
-
7) true or false: life for the loyalists was easy during the revolution…
B. FALSE
-
5) what was a loyalist during the revolutionary war? a. a person who re…
C. A person living in the American colonies who wanted to stay a part of Great Britain
-
the estimated number of organisms in a population after t days is shown…
$n = 600(1.2)^t$
-
read the following text from an essay. this excerpt is about the influe…
Christian missionaries brought Nigerian ethnic groups together.
-
over time, the number of organisms in a population increases exponentia…
24
-
fermentation requires oxygen true false
False
-
reflection: how does this blending of the real and the supernatural cha…
The blending of the real and supernatural challenges our understanding of cycles of violence by making us question cause - and - effect, complicates our view of memory by suggesti…
-
in which theory of the origin of the state did individuals or a group s…
D. force theory
-
compared to the other steps in cellular respiration, fermentation is in…
True
-
one molecule of glucose can produce up to ____________ atp molecules. 4…
B. 38
-
4. a glucose molecule has a molecular formula of c₆h₁₂o₆. when two gluc…
A water molecule is removed during the condensation reaction that links two glucose molecules to form maltose. ### 5.
-
three basic catabolic pathways include all the following except: aerobi…
C. photosynthesis
-
atp has a negative charge. true false
True
-
which of the following is not a component of atp? ribose sugar adenine …
D. 3 fatty acids
-
in aerobic metabolism ______________ is the final electron acceptor. ni…
B. oxygen
-
the most common electron carrier is ______________. nadh nad fadh
A. NADH
-
in metabolic pathways, the product of a reaction can become the _______…
B. substrate
-
which of the following does not affect an enzyme? water heat ph chemica…
water
-
the ______________ is where a substrate binds to an enzyme. active site…
A. active site
-
__________ breaks down smaller molecules into larger molecules, and ___…
B. catabolism, anabolism
-
multiple - choice question the children and the teachers laughed and ch…
B. simple
-
an enzyme speeds up a chemical reaction in the cell, but can only be us…
False
-
you show me the way that i was going, and are the instrument i was goin…
1. His guilt - ridden and over - ambitious state of mind (fatal vision as a result of his internal turmoil). 2. It fulfills his ambition and prompts him to follow the witches' pro…
-
based on the field research with pikas, our data showed that as the tem…
D. negative
-
directions: read each danger scenario. decide which safety device would…
1. Best device: Gate with Switch. Why: Detects door opening, stops robot. 2. Best device: Light Curtain. Why: Detects intrusion into robot path, stops robot. 3. Best device: IR Se…
-
the horsepower (hp) that a shaft can safely transmit varies jointly wit…
$1.39$
-
2) many of the worlds largest cities are near the coast. what are some …
1. Trade and commerce: Coastal locations have ports which enable international trade, facilitating the exchange of goods and services, and attracting businesses and industries. 2.…
-
5. which of the following were most responsible for influencing the poi…
D. religion and philosophy
-
question 35 how quickly an ecosystem recovers is known as ____________ …
resilience
-
1) there are subdivisions within the study of oceanography. give two ex…
a) Physical Oceanography: Wave motion, Ocean currents b) Geologic Oceanography: Seafloor spreading, Submarine volcanoes c) Chemical Oceanography: Salinity variations, Dissolved ox…
-
secondary succession occurs o after a new food web is established. all …
All of these are correct.
-
solving exponential and logarithmic equations pre - test complete 1 bas…
40
-
the horsepower (hp) that a shaft can safely transmit varies jointly wit…
The diameter of the shaft must be approximately $1.4$ inches.
-
the five basic components of a robot are: manipulator, end effector, co…
Manipulator, End Effector, Controller, Drives, and Teach Pendant
-
4. represent data build an energy pyramid using the data in the table. …
Energy pyramid: Place species A at the bottom (producer), then C, D, and B successively higher up. B is likely a top - level consumer, C and D are intermediate consumers.
-
a scientist has discovered an organism that produces five offspring exa…
19,531
-
refer to explorations in literature for a complete version of this stor…
It allows him to describe the banker's self - contempt when the banker reads the lawyer's essay.
-
which of the following is most likely to be included in a traditional j…
key words such as what, when, where, who, how and why
-
1. the third enzyme you will be investigating is pepsin. like trypsin, …
12
-
the four types of listening that may be employed in interviews are mult…
comprehension, empathy, evaluation, and reaction
-
2.3 review 1. sequence list the types of organisms in order from the to…
1. Producer, primary consumer, secondary consumer, tertiary consumer 2. Energy is lost at each trophic level as heat and for metabolic processes. 3. A fire would lead to a narrowe…
-
a piston uses 32 j of energy to do work as 68 j of heat are added to th…
36
-
stability and change deciduous trees lose all their leaves each autumn.…
In autumn, the number of primary and secondary consumers may decrease due to reduced food availability from leaf - loss in deciduous trees. In seasons with more foliage, consumer …
-
in the formula used to solve problems related to the first law of therm…
B. heat
-
sep use mathematics a population of top predators consumes 7 kcal/m² pe…
700 kcal/m²
-
consider your data and consider this ph scale. identify the two ph clas…
Weakly acidic pH values, Neutral pH value
-
part iii: prince william sound gttcacagt tgagct gtggtattttacgcatagact t…
5. d. Which otter families are most closely related to each other? 7 a. (Answer depends on actual comparison of sequences. For example, if Cook Inlet's sequence is very similar to…
-
who among the following use a moderately scheduled interview? multiple …
C. All of these answers are correct
-
problem 2 having a crew of the international space station requires lif…
Life support
-
2) scientists are trying to study the relationship between the weight o…
a) A scatter - plot should be made by hand or using software (e.g., Excel, R, Python's Matplotlib) with the given data points. The non - linearity can be visually confirmed as the…
-
regarding internal career design, which of the following is something t…
if one's career steps are sustainable
-
which of the following is a definition of internal career design? a pla…
a plan for achieving goals and desires within a career
-
when should one evaluate their internal career design? quarterly never …
constantly
-
which of the following is necessary to create an internal career design…
to have a career in mind
-
check your progress 1. distinguish producers, consumers, and decomposer…
1. Producers make food via photosynthesis, consumers eat others, decomposers recycle dead matter. 2. Grass → Zebra → Lion shows energy flow from sun - to - producer - to - consume…
-
what is the first step of internal career design? to finish what one is…
to make a detailed list of career goals
-
why do historians consider the battle of saratoga to be the turning - p…
It convinced the French to join the war on the side of the Americans.
-
this is an excerpt from a letter written by george washington at valley…
A lack of supplies made it difficult for the army to function properly.
-
the painting of the battle of bunker hill shows a strategy used by brit…
American generals used guerrilla warfare; they used the landscape to their benefit and fought only when they held a significant advantage.
-
each organisms trophic level. grass - 1st tropic level grasshopper - pr…
Humans are omnivores and can be primary, secondary or tertiary consumers, occupying different trophic levels based on diet.
-
review the womens clothing store advertisement and then answer the ques…
to entice readers to come shop at the store
-
review the journal entry and then answer the question. monday, november…
The writer provides a factual record of the ship's activities.
-
read the journal entry and then answer the question. monday, november 1…
authorities financing the expedition
-
general questions: 1. what gas must be present in order for organisms t…
1. Oxygen 2. Nitrite 3. Evaporation and condensation 4. Nitrogen cycle 5. Saltwater 6. Evaporation 7. Rain, snow, sleet, hail 8. Evaporation 9. Bacteria 10. Carbon, hydrogen, oxyg…
-
get 5 of 6 correct stage 1 beautiful music. each musician plays an inst…
C. The human body is made up of smaller parts working together. D. Organs are made of tissues.