生物
細胞生物學、遺傳學、生態學與生命科學基礎。
-
after digestion and absorption, where are the remaining ingestible prod…
the large intestine
-
investigation 1: biochemistry identify the four types of macromolecules…
H: 2, C: 1, O: 3 ### Question 15
-
many people viewed sacco and vanzetti with suspicion because they were …
A. Italian immigrants and anarchists. ### Second Question (John T. Scopes)
-
multiple choice the purpose of the volstead act was to * 1 point ban th…
C. enforce Prohibition. ### Second Question (Who founded the Universal Negro Improvement Association?)
-
date: lifework 1. why does every organism need to do respiration in som…
Every organism needs respiration to obtain energy (in the form of ATP) from organic molecules (like glucose) to power essential life processes (growth, metabolism, movement, etc.)…
-
a group of students wanted to see what affect adding gingko biloba woul…
a. The addition of Gingko biloba (or the presence of Gingko biloba in the diet) b. The growth (mass) of the guppies c. The group of 10 guppies fed their regular diet (without Ging…
-
identify the control group in an experiment and explain why it is impor…
7. control group 8. A control group provides a baseline to compare with the experimental group (the group exposed to the independent variable). It helps determine if the independe…
-
2. a weightlifter is using heavy weights in short bursts for a competit…
A. As the cells run out of oxygen they switch to anaerobic respiration, which allows the cell to make small amounts of ATP in the absence of oxygen. mitochondria
-
5. the _____________ variables (constants) are those things that must n…
controlled ### Question 6
-
2. a potted plant is placed inside a clear, sealed vacuum container tha…
C. The plant will die because it does not have carbon dioxide for photosynthesis C. Photosynthesis occurs at the highest rate under the most intense light
-
7. the human body maintains a temperature of around 98.6 degrees at all…
A. Enzymes function best at a specific temperature. D. The reactions are too slow to meet the needs of the cell if enzymes are missing.
-
5. two test tubes were filled with a solution of bromthymol blue. a stu…
B. Carbon dioxide was removed by photosynthesis. B. When an enzyme catalyzes a reaction, it decreases the activation energy of the reaction.
-
identify the variables in an experiment and classify each as independen…
3. An independent variable is the variable that is deliberately manipulated or changed by the experimenter in an experiment to observe its impact on another variable. 4. The depen…
-
9. ovalbumin is a protein found in eggs. which of the following best de…
B. a chain of amino acids folded and twisted into a molecule A. polymers of smaller subunits
-
what is the chemical term for the long molecules made of smaller repeat…
Polymers (the option with the label "Polymers")
-
read this excerpt from \choreographers of matter, life, and intelligenc…
B. to provide evidence that the age of discovery is concluding
-
read this excerpt from \why no policeman on the block?\ any neophyte su…
A. to prove that the Internet needs improvement
-
28. carrot sticks that are left in a dish of freshwater for several hou…
A. hypotonic, hypertonic C. have serious, perhaps fatal effects because the red blood cells would tend to burst
-
24. if a cell’s lysosomes were damaged, which of the following would mo…
C. The cell would be less able to break down molecules in its cytoplasm. A. active transport
-
22. what is the advantage of cells being so small? a. small cells conta…
D. The cell then has a larger surface area to volume ratio which means it can move nutrients into the cell and waste out more efficiently. A. Increases surface area in order to pr…
-
read this excerpt from \choreographers of matter, life, and intelligenc…
B. Newton’s discoveries led to the invention of machines and the beginning of an industrialized society.
-
14. muscle cells are responsible for obtaining energy so the body can p…
B. The muscle cell would have more mitochondria than the other types of animal cells. B. The organism's internal structures.
-
read this excerpt from \dna testing.\ dna samples from insects preserve…
A. Amber has allowed scientists to study DNA that has been preserved over millions of years.
-
need step this step develops the need for change. now that you have you…
Social Science - Psychology
-
which form of life on land appears in the fossil record before all the …
D. plants
-
an artist who was famous for his lifelike depictions of the human body …
D. Michelangelo
-
which of the statements regarding the nitrogen cycle is true? choose 1 …
C. Nitrogen fixation is the process atmospheric nitrogen is converted into biologically usable forms.
-
reference the website below and answer the following question. http://w…
D. trilobites
-
during the renaissance, an artist who was considered a enaissance man\ …
C. da Vinci.
-
topic sentence(point):teen drug use is a big and harmful problem that n…
Social Science - Psychology
-
sc.912.e.7.1: carbon and water cycles 1. leaves fall from deciduous tre…
# Brief Explanations: To determine which organism appeared first, we refer to the fossil record and the provided website (http://www.ucmp.berkeley.edu#/f Answer: B. decomposition
-
reference the website below and answer the following question. http://w…
# Brief Explanations: To determine which organism appeared first, we refer to the fossil record and the provided website (http://www.ucmp.berkeley.edu#/f Answer: B. decomposition
-
34. list the scientific two advantages of sexual reproduction:
1. Enhanced genetic diversity (offspring inherit a unique mix of genes from two parents, increasing the population's ability to survive environmental changes or resist diseases). …
-
part 3: circle the correct answer a. which has a longer wavelength? mic…
Microwaves #### b.
-
11. whaling was a very profitable profession until whale populations cr…
B. The whale populations are not rebounding as quickly as they might if all of the countries agreed not to hunt whales.
-
front cover of your textbook. potential hazards of acetone may cause ey…
- Wear appropriate personal protective equipment (PPE) like safety goggles, gloves, and a lab coat. - Work in a well - ventilated area (preferably a fume hood) to minimize inhalat…
-
language building activity levels of organization circle the correct wo…
### Levels of Organization 1. **Step 1: Recall biological organization levels** Cells form tissues, tissues form organs. So tissues work to make organs. Circle: Tissues 2. **Step …
-
7. new fuels are being produced by converting corn and grasses into com…
A. reduce the use of nonrenewable resources. A. ecosystems are interconnected and human action can alter ecosystem equilibrium.
-
5. some people see the benefit of wind energy as a clean alternative to…
B. must be made by weighing the risks and costs against the benefits B. The populations of wetland animals would be unable to survive in that area.
-
3. after the aswan high dam was built on the nile river, the rate of pa…
B. the influence of humans on a natural system can have unpredictable negative impacts D. learn about the interactions of population
-
attention step hook the audience’s attention with one of these techniqu…
Psychology (under Social Science)
-
why did the french and latin american revolutions lead to political ins…
B. The American Revolution had leaders with government experience, while the French and Latin American Revolutions had leadership conflicts.
-
part a- deducing phenotypes and genotypes of selfed parents mendel stud…
(Assuming the correct parent phenotypes after deduction, e.g., Plant 4: wrinkled green, Plant 1: round green, etc. But since the exact drag-and-drop isn't fully visible, the key i…
-
attention step: hook the audience’s attention with one of these techniq…
Arts - Writing
-
which of the following fields of study relates to the way that human cu…
A. political science
-
listen match each leader with their role in the revolutions. move one a…
- led the Reign of Terror during the French Revolution: Maximilien Robespierre - helped liberate Latin American nations from Spanish rule: Simón Bolívar - fought for independence …
-
3. when an environment has reached its carrying capacity for a certain …
A. Growth and immigration rate is equal to death and emigration rate. C. The possum population grew to a larger size.
-
how did the latin american revolutions affect social inequality? wealth…
D. Some legal restrictions were removed, but racial and economic divisions persisted (assuming the options are labeled A - D with D being this option; if the original options had …
-
1. jill made the table below during her research on aquatic zones and l…
B. There are no producers in the benthic zone that rely on photosynthesis C. There are more consumers than producers
-
as of 2020, however, there has been a significant change that will make…
- DNA fingerprinting will become obsolete. - DNA testing will become more sophisticated. - DNA sequencing can be done from dandruff. - DNA can reveal all of a person’s characteris…
-
use the phenotypes of the f₁ progeny to deduce the genotype and phenoty…
For each plant (1 - 4), the parent phenotype is G₂ (the pink - labeled G₂) and genotype is G₁ (the blue - labeled G₁). So: [SSE Completed, Client Connection Error][SSE onError err…
-
need step this step develops the need for change. now that you have you…
Arts - Writing
-
the inheritance of abo blood type involves three possible alleles. true…
True
-
27. the seed - grown plant is an example of asexual / sexual reproducti…
First blank: sexual; Second blank: combination
-
in what frequencies would you expect the offspring genotypes? indicate …
- \( I^A I^B \): \( \frac{1}{4} \) - \( I^A i \): \( \frac{1}{4} \) - \( I^B i \): \( \frac{1}{4} \) - \( ii \): \( \frac{1}{4} \)
-
listen what was a long - term challenge faced by newly independent lati…
B. disputes over national identity and territorial boundaries
-
what genotypes would you expect in future offspring from this marriage?…
Assuming a common \( I^A i \times I^B i \) cross (type A and type B heterozygous parents), the applicable genotypes from the options are: - \( ii \) - \( I^A i \) - \( I^B i \) - …
-
what is a common misconception about evolution? that evolution is an ex…
B. that it is a linear progression from lower to higher forms of life
-
listen what was one major cause of the political instability that follo…
A. the lack of experience in self - governance among newly independent nations
-
part a what is the genotype of the man? options: ii, i^a i, i^b i, i^a …
Part A: \( I^A i \) (the option labeled \( I^A i \)) Part B: \( ii \) (the option labeled \( ii \))
-
part b what is the genotype of the woman? options: ii, i^a i, i^b i, i^…
\( ii \) (the first option, labeled "ii")
-
12. jake conducted an experiment with four plants. they were planted ne…
A. carry out multiple trials, and increase the number of plants that are given each type of water
-
a man with type a blood and a woman with type b blood have a child with…
$I^A i$ (the option labeled $I^A i$)
-
why was king louis xvi put on trial and executed in 1793? he refused to…
D. He was accused of conspiring with foreign nations against the revolution.
-
part a you cross a true-breeding red-flowered snapdragon with a true-br…
Red shows incomplete dominance over white.
-
1. competition between two species occurs when: a. mold grows on a tree…
B. Chipmunks and squirrels eat sunflower seeds in a garden B. Birthrate and death rate are close to equal
-
listen drag and drop the correct term into the blank to complete the se…
severe economic crisis
-
part a height in humans generally shows a normal (bell - shaped) distri…
a combination of polygenic inheritance and environmental factors
-
a tall, purple - flowered pea plant (ttpp) is allowed to self - pollina…
ttpp
-
why did the storming of the bastille become a significant event in the …
D. It showed that the people were willing to use force against royal authority.
-
which cell in this figure is the first to be haploid? options: d, a, c,…
C
-
two mice are heterozygous for albinism (aa). the dominant allele (a) co…
25
-
which letter in figure 19.7 identifies a primary spermatocyte? options:…
B
-
if an organism with the genotype aabb produces gametes, what proportion…
None (the option with "None")
-
question 48 1 pts which of the following would be found in the oviduct …
B. a zygote (assuming the options are labeled as A. an embryo, B. a zygote, C. an ovum, D. a spermatocyte; if the original option numbering is different, adjust the identifier but…
-
part d true or false? in diploid organisms, a dominant phenotype will o…
False
-
why did american indians face long - term challenges after the american…
The end of British rule meant the US could expand westward, leading to land loss and conflicts with Native tribes.
-
part c true or false? the same phenotype can be produced by more than o…
True (the option "True")
-
what was a major political challenge faced by the united states immedia…
the inability to tax or regulate trade under the Articles of Confederation
-
when constructing a punnett square, the symbols on the outside of the b…
A. gametes, progeny
-
what is the difference between heterozygous and homozygous individuals?…
All of the gametes from a homozygote carry the same version of the gene while those of a heterozygote will differ.
-
select the correct answer. how did ancient greek and roman texts contri…
C. They introduced Italian scholars to academic fields that promoted individual growth and thinking.
-
which statement correctly summarizes both the short- and long-term effe…
The war caused economic struggles, food shortages, and debt in the short term, but over time, it led to the growth of democratic ideas and the formation of a new government.
-
part a in his breeding experiments, mendel first crossed true - breedin…
The option with "P... F₁... F₂" (the fifth option in the list of radio buttons).
-
which of the following statements accurately describes similarities bet…
Both processes generate offspring that carry parental genes. ### Question 47 (Type 1 Diabetes)
-
part a what is an allele? view available hint(s) ○ the dominant form of…
D. an alternative version of a gene
-
question 44 1 pts which of the following is correct about homeostasis? …
All living things must maintain homeostasis in order to survive. ### Question 45
-
a college student tracks his diet for several weeks as part of a nutrit…
vitamin K ### Second Question (Male Reproductive Tract)
-
how did enlightenment ideas influence the expansion of european states …
They promoted the spread of reforms such as religious tolerance and centralized governance.
-
the structure that is highlighted in this illustration of a knee joint …
tendon.
-
which combination of actions best represents how monarchs applied enlig…
reducing noble privileges, centralizing power, and introducing legal reforms
-
which of the following statements about the amino acids that are requir…
Amino acids are the building blocks of proteins. ### Second Question (Muscle Figure):
-
invasive species • ____ with few enemies • ____ • ____ island specialis…
- First blank (invasive species): Flourish - Native species blank: defenses - Vulnerable islands: Small & Far - Lower biodiversity ecosystem extinction rate: higher - High biodive…
-
which of the following structures provides a function similar to oil in…
synovial sac (the option: $\boldsymbol{\text{synovial sac}}$) ### Second Question (Which of the following things would you expect to happen if a knee joint was formed without any …
-
look at the test tubes on the right. benedicts tests for simple sugars …
- complex carbohydrates (marcar la casilla) - lipids (marcar la casilla) (Nota: También puede haber pequeñas cantidades de proteínas, pero los componentes más característicos de l…
-
how were the causes of the french revolution different from those of th…
C. The French Revolution sought to end monarchy and feudal privileges, while the American and Latin American revolutions sought independence from foreign rule.
-
video links safeshare.tv link: https://safeshare.tv/1vcm original youtu…
### DNA Sequence #1 - mRNA: AUGAUUGCGGGGAGAAUGUUUUUAUUAA - AA: Met - Ile - Ala - Gly - Arg - Met - Phe - Leu - (stop) ### DNA Sequence #2 - mRNA: UUAUGCGGGGCGCAUUAACAAAUCUUAAG - A…
-
which best describes a key characteristic of a political revolution? a …
C. a significant change in government, often involving conflict or rebellion against authority (assuming the third option is labeled C; if the original labels were different, adju…
-
based on the image provided, which of the following is the first to app…
Platelets ### Second Question (Autoimmune Disease)
-
which of the following statements about memory cells is true? they are …
They include B cells and T cells that remain in the body for long periods of time after the first exposure to a pathogen. ### Question 34 (Swelling and Soreness of Lymph Nodes)