生物
细胞生物学、遗传学、生态学与生命科学基础。
-
question 4 points 2 what was the primary goal of the world trade organi…
Promote free trade and reduce trade barriers
-
in your own words, what did you learn in this unit about the connection…
Motivation and emotion are intertwined. Biologically, neurotransmitters play a role, and culturally, values and norms are involved. To be more motivated, align goals with values a…
-
personality? give evidence from the lessons to support your reasoning. …
No specific answer as it requires personal analysis and reflection based on the lessons studied. Responses would vary depending on the content of the lessons.
-
7. organisms keeping internal conditions constant is an example of what…
7. Homeostasis 8. Structure: Composed of fatty - acids and glycerol. Function: Energy storage, cell - membrane components, hormones. 9. Hydrogen bonds. Importance: High surface te…
-
question 18 (2 points) when the weather is harsh, the population typica…
True
-
question 16 (2 points) human pollution can damage the ecosystems anywhe…
True
-
which is a true statement about the neolithic revolution? the neolithic…
# Breve Explicación: La Revolución Neolítica fue un proceso lento que se desarrolló durante miles de años, con el cambio a la agricultura y la domesticación de animales. No fue rá…
-
question 6 3 pts which of the following is the best definition of the w…
something that furnishes proof
-
approximately how long ago did the neolithic revolution begin? about tw…
A. about twelve thousand years ago
-
as a result of the neolithic revolution, by 3,000 bce the worlds human …
C. twenty - five million
-
directions: using your icivics worksheet, \who rules?\, create definiti…
Democracy: Rule by the people. Direct democracy: People directly participate in governance. Representative democracy: People elect representatives to govern. Oligarchy: Rule by a …
-
mutations worksheet there are several types of mutation: deletion (a ba…
Original DNA Sequence: T A C A C C T T G G C G A C G A C T mRNA Sequence: A U G U G G A A C C G C U G C U G A Amino Acid Sequence: Met - Trp - Asn - Arg - Cys - stop Mutated DNA S…
-
1. read this excerpt from john smiths journal, and identify the meaning…
D. great trouble
-
directions: read the information below and complete the questions. elab…
1. Monomers are the building blocks of biomolecules. For carbohydrates, the monomer is a single - sugar molecule like glucose; for proteins, it's amino acids; for lipids, it can b…
-
3. sally wants to test how the type of light affects the height of bean…
the type of plant, the amount of light, the type of light
-
1. sally wants to test how the type of light affects the height of bean…
the type of light
-
question 6 (2 points) which natural disaster has the highest probabilit…
an earthquake
-
multiple choice 1 point everyday cellular phone companies are expanding…
increase due to an increase in demand.
-
in which spiritual concept do most hindus believe? ○ final noble truths…
reincarnation
-
directions: watch the video and then complete the activity below. biomo…
1. C 2. P 3. L 4. P 5. C 6. N 7. L 8. P 9. L 10. C 11. N 12. L
-
pandas are solitary creatures that spend most of their time in the wild…
It emphasizes how pandas are used to support international conservation efforts.
-
bell ringer a2 associated with water allele allele frequency analogous …
D. aquatic
-
bell ringer a2 structures in different organisms that have the same fun…
C. analogous structures
-
bell ringer a2 how often an allele occurs in a population o allele o al…
B. allele frequency
-
bell ringer a2 a version of a gene due to a variation in the nucleotide…
A. allele
-
early growth quick check what conditions contributed to congresss vote …
British impressment of U.S. soldiers, British support for Native American resistance
-
lesson goals i can explain how carbon can form chains and ring structur…
Biomolecules support life by providing energy (carbohydrates, lipids), catalyzing reactions and providing structural support (proteins), and storing and transmitting genetic infor…
-
which elements are present in each type of molecule? start by filling i…
| Molecule Type | Carbon | Hydrogen | Nitrogen | Oxygen | Phosphorus | Sulfur | | --- | --- | --- | --- | --- | --- | --- | | Proteins | Always | Always | Always | Always | Someti…
-
question 1) what about jim’s actions are unethical? select all that app…
a) Jim and his partner have almost identical reports b) Jim was not shocked at the plagiarism concern from Professor Hernandez c) Jim did not think he did anything wrong d) Jim do…
-
how does the image of buddha tend to vary from statue to statue? some h…
C. The Buddha's hands can be placed in a variety of positions.
-
14. which word is an antonym for the word spasmodic? a. calm b. decent …
14. A. calm 15. D. It emphasizes the Great Actor’s incredible talent. 16. A. “We bowed our assent.” 17. C. He worries the interview will not reach the public.
-
how do the properties of water make it essential for life on earth?
Water's high heat - capacity, cohesion, adhesion, and solvent properties make it essential for life on Earth.
-
the permaculture model, which mixes multiple plant species in ways that…
The text suggests that permaculture methods can match industrial farming's productivity while reducing environmental impact, but leaves uncertain whether such a shift is viable wo…
-
unit 1: instructional sequence 1 draw a water molecule and explain how …
Polarity - C Cohesion - A Adhesion - B Universal solvent - E Temperature modification - D Expansion upon freezing - F
-
2014 university of zurich study demonstrated that such polyculture syst…
The text suggests that alternatives to industrial farming could be more sustainable and productive, but leaves uncertain whether natural and economic goals can align in practice g…
-
which sentence best uses a split infinitive to clearly emphasize the me…
Young drivers must remember to always turn off cell phones before getting behind the wheel.
-
which of the following is not required for an area to be considered a h…
A. Mammals
-
christian barnard is known for: * publishing the first anatomy book inv…
performing the first successful heart transplant
-
underground tunnel even connects residents to the neighboring school, a…
Given that former military spaces designed for efficiency now foster social connections, Whittier’s residents likely adapted utilitarian spaces into more welcoming ones.
-
shortly before the game, fifa, the international soccer association tha…
The author mentions a funding discrepancy between the two teams, indicating that there were multiple factors contributing to the lopsided score.
-
macromolecule matching read each of the statements below and select whi…
1. C. proteins 2. C. proteins 3. A. carbohydrates 4. B. lipids 5. A. carbohydrates 6. D. nucleic acids 7. C. proteins 8. D. nucleic acids 9. B. lipids 10. A. carbohydrates 11. C. …
-
part a classification of living things worksheet use internet resources…
| Type | Is it made up of cells? | Does it obtain and use materials and energy? | Does it maintain a stable internal environment (homeostasis)? | Does it grow and develop? | Does …
-
ecological footprint by mathis wackernagel and bert beyers everyone, bi…
Methods to determine each person's impact on the Earth's resources have been developed
-
receptor - mediated endocytosis is used to remove low - density lipopro…
D. Patients would have very high LDL levels and a high risk of heart disease.
-
part a drinking too much plain water in a short period of time can resu…
B. Cells may be lysed.
-
edna st. vincent millay, \i shall go back again to the bleak shore\ how…
By contrasting a fleeting human connection with the familiar yet desolate shore, the poet develops the idea that people seek refuge in the stability of nature.
-
collaboration showed measurable improvement. these benefits derive from…
The text suggests that the MBTI can effectively improve self - awareness, but leaves uncertain whether these benefits translate to quantifiable performance outcomes.
-
part a red blood cells placed in 5% sodium chloride solution will _____…
A. lose water and undergo crenation
-
during the industrial revolution, many governments adopted an economic …
B. Capitalism was beneficial for some people during the Industrial Revolution, but others opposed the system
-
multiple - choice question what is the largest ecosystem in the world? …
B. Sea/Ocean
-
part a red blood cells placed in a hypotonic solution will ______. gain…
A. gain water and undergo hemolysis
-
read the passage. before rock and roll became famous in the 1950s, gosp…
Given that many music fans remain unaware of Tharpe's influence, she likely found less commercial success than later rock musicians.
-
part 1: key terms - match the concept with the letter that corresponds …
1. E. The social science concerned with study of people and choices 2. G. The value of your next best alternative 3. A. The idea the we have unlimited wants but limited resources …
-
a dialysis sac that is permeable to glucose and water is filled with wa…
Yes, glucose will move into the sac.
-
question 6 of 10 suzette has some friends who tease her and try to pers…
A. True
-
multiple - choice question true or false: living things depend on other…
True
-
part 3: chart activity fill in the chart with the goals of each leader …
**Part 3**: Prince Metternich, Austria: Goal - Restore balance of power and suppress revolution; Outcome - Re - establishment of conservative order Tsar Alexander I, Russia: Goal …
-
part a in comparing simple diffusion to facilitated diffusion, you note…
D. both require a concentration gradient
-
5. sep construct an explanation develop explanations supported by model…
5. The carbon cycle is vital for ecosystem stability as it recycles carbon among atmosphere, biosphere, etc. It provides carbon for photosynthesis and respiration, maintaining bal…
-
part a in __________ processes, the cell provides energy in the form of…
B. active
-
part a which of the following would require an input of energy? diffusi…
C. vesicular transport
-
part a a solution surrounding a cell is hypertonic if __________. ○ it …
A. it contains more nonpenetrating solute particles than the interior of the cell
-
part 3: chart activity fill in the chart with the goals of each leader …
**Part 3 Chart Activity**: - Prince Metternich (Austria): Goal - Restore and maintain balance of power, suppress revolution; Outcome - Played leading role, re - established pre - …
-
part a a passive process, ________ is the movement of solute molecules …
B. diffusion
-
translate to english: \¿a qué hora es tu clase de biología?\ \at what t…
"At what time is your Biology class?"
-
9. scientists think the moon was formed when a. a large object struck e…
9. a. 10. b. 11. a. 12. c. 13. a. 14. d. 15. d.
-
multiple - choice question why isnt a farm an ecosystem? it is an ecosy…
It is an ecosystem because it has both biotic and abiotic factors
-
read this passage about a unique education program. then, select the in…
The program's students setting international records - like fourteen - year - old Donna Meyers performing a double somersault on the flying trapeze.
-
macromolecules macro means _ macromolecules are _ that are critically i…
Macro means large; Macromolecules are large molecules; Mono = one, Mer = unit; Poly = many
-
1. what html element is used to create a hyperlink, and what essential …
1. `<a>` element, `href` attribute 2. Specifies link destination 3. Images, buttons 4. Internal: within - site, External: to other sites 5. Gives tooltip info, has accessibility i…
-
which of the following is/are true regarding southern christian leaders…
It is an organization that was established in 1957 in support of civil rights activism. It was founded by Martin Luther King, Jr., with the support of other civil rights activists.
-
are sea water, rocks, sand and silt abiotic or biotic? abiotic biotic r…
A. Abiotic
-
which of the following was not an advantage of the continental army dur…
D. Having a strong Navy
-
which battle was known as the turning point of the revolutionary war? t…
1. D. Saratoga 2. A. An enslaved person seeking freedom
-
1 multiple choice 20 points which of the following was englands main st…
1. Blockade the colonies and force them to surrender. 2. Articles of Confederation
-
14. which is an invention of the industrial revolution? the cotton gin …
the cotton gin
-
multiple - choice question what does biodiversity mean? all different k…
All different kinds of living things
-
part 2 - evaluate human impact discuss and evaluate the implications of…
Discuss benefits like economic growth. Note risks like habitat loss. Give examples of global ecosystem links.
-
part 3 - communicate your ideas use visuals, diagrams, or models to cle…
Create clear, organized visuals to explain ecosystem functions to non - experts.
-
part 1 - explain the science clearly explain how ecosystems function, i…
Ecosystems function via complex interactions of organisms, energy flow, matter cycling, and key metabolic processes.
-
1. multiple choice 20 points which economic philosophy allowed the brit…
1. Salutary neglect 2. Because of how far the colonies were from Britain
-
multiple - choice question __________ remove damaged bone, while ______…
A. Osteoclasts; osteoblasts
-
aisha has just found out that she is pregnant. she is actually just two…
D. wall of the uterus
-
model 2 - dna sample comparison sample 4 gtttcagaacttgtgctatc sample 3 …
8. Sample 1: 20 bases, Sample 2: 20 bases, Sample 3: 20 bases, Sample 4: 20 bases, Organism A: 20 bases 9. None 10. Sample 1 (assumed) 11. 12 (assumed based on comparison of assum…
-
multiple - choice question cartilage is responsible for- supporting joi…
D. all of the above
-
how do ecosystems work, and how can understanding them help us protect …
Ecosystems are complex webs of interactions. Knowledge aids protection by guiding management and conservation efforts.
-
question 6 of 10 in 1917, communist revolutionaries overthrew the russi…
A. Russia was ruled by leaders with absolute power from 1721 until 1917.
-
question 2 of 10 in 1990, the middle eastern country of iraq invaded it…
B. A recorded conversation between Iraq's generals the day before the invasion
-
multiple - choice question osteoclasts have lots of which organelle to …
lysosomes
-
red bone marrow is responsible for making- all of the above platelets r…
all of the above
-
directions: read each question carefully, and record your answers at th…
1. D 2. C 3. B 4. A
-
12 multiple choice 5 points when people started getting sick from air p…
12. Public opinion 13. Paris Agreement
-
multiple - choice question where are red blood cells made? spongy bone …
spongy bone tissue
-
multiple - choice question where are red blood cells made? spongy bone …
spongy bone tissue
-
the image shows a british political cartoon called \good hunting.\ whic…
Hitler stole Austria's integrity in violation of international law.
-
model 1 - phylogenetic trees millions of years ago 40 35 30 25 20 15 10…
1. a. 40 million years ago b. Raccoon and the common ancestor of Red Panda, Pandas and Bears c. Sloth Bear, Sun Bear, Black Bear, Polar Bear, Brown Bear 2. 20 million years ago 3.…
-
part 1 - explain the science clearly explain how ecosystems function, i…
No specific answer as it's a set of tasks. Need to explain ecosystem functions, evaluate human impact, use visuals, and cite sources.
-
the appendicular skeleton consists of the bones of the arms, hands, sho…
true
-
question 5 of 5 what does marian compare the womens room to in a visit …
C. A robber's cave
-
multiple - choice question the skeletal system is responsible for - (ch…
housing minerals and ions, protection, helping the muscular system move the body, support and structure, making red and white blood cells