生物
细胞生物学、遗传学、生态学与生命科学基础。
-
cat in danger by guy beloranil the scrambled words below are vocabulary…
1. subspecies 2. feral 3. dusk 4. disease 5. stability 6. solitary 7. visible 8. endangered 9. crooked 10. territorial
-
when a cell copies a dna molecule: 1. dna is unzipped. 2. the complemen…
1. \(TTGCATGCTAGCTACGTGTACGTACCGATGCG\) 2. \(GGCCCCATACGTACATGCATGCAGCATATAGC\) 3. \(GCGCTAGCTCGCTAGCTGCTTACGGATCAAAAA\) 4. \(AATTTGCTCGACGATCGATAAAAAATTTTTGGGGGC\) 5. \(GGCGAAAGC…
-
name class date active reading continued skill: interpreting graphics 4…
- Part a: DNA helicase unwinds the DNA double - helix. - Part b: DNA polymerase synthesizes new DNA strands. - Part c: Two new DNA molecules (semi - conservatively replicated) are…
-
match the description on the left with the correct term on the right. a…
1. c. carbohydrate 2. b. protein 3. a. lipid 4. b. protein 5. b. protein 6. a. lipid 7. d. nucleic acid 8. a. lipid 9. c. carbohydrate 10. b. protein
-
question 2 in the \identifying known and unknown biological substances\…
d. Glucose
-
question 1 match the description on the left with the correct term on t…
1. c. Lipids test 2. e. Glucose test 3. a. Protein test 4. b. Starch test
-
which tone is exemplified by the line, \hear me, my chiefs, i am tired;…
resignation
-
why is hamlin garlands \the return of a private\ correctly classified a…
The story gives a faithful representation of characters, settings, and events that readers recognize and relate to.
-
the diagram below shows a bacterial cell. the bacterial cell does not h…
Left box: cytoplasm containing cell parts. Right box: cell membrane.
-
read the timeline from sugar changed the world. 1789 french revolution …
The details about the changing laws in France help inform readers that Napoleon wanted to produce sugar cheaply by using enslaved people.
-
define the following terms: trophic level- ________________________ ten…
- Trophic Level: Position in a food chain (producer, consumer, etc.). - Ten Percent Rule: Only about 10% of energy transfers between trophic levels. - Phytoplankton: Microscopic a…
-
what makes source evaluation crucial? a. finding the longest sources b.…
- First question: d. Testing reliability - Second question: a. To find strategies to combat rising sea levels - Third question: c. Expert evaluation - Fourth question: c. By logic…
-
taking guided notes is an excellent way to stay focused during lessons.…
A. systematic When evaluating sources, it's important to check the author's expertise and publication date. Information that has been evaluated and approved by experts in the fiel…
-
taking guided notes is an excellent way to stay focused during lessons.…
A. systematic When evaluating sources, it's important to check the author's expertise and publication date. Information that has been evaluated and approved by experts in the fiel…
-
the electoral college makes the decision to elect which of the followin…
president
-
22. how should writers cite sources? a quote entire passages b use prop…
- 22: B. Use proper format - 23: C. She documented it and sent samples to a research center - 24: B. Notes
-
read the following original passage, sarahs explanation of photosynthes…
16. A. Water and carbon dioxide 17. B. Purpose 18. B. Comprehensively theoretical
-
read the following original passage, lilys research on climate change, …
9. a. She crafted a more comprehensive argument 10. d. Analysis 11. b. Statistics
-
1 expert opinions depend on: a publication history b personal experienc…
1. d. Knowledge 2. b. Cause - effect 3. b. A study from a reputable journal and expert opinions
-
causes of the french revolution use the drop - down menus to complete t…
The French Revolution began as a demand for equality by people in the lower classes. They wanted to put an end to absolute monarchy in France. After the revolution, the country ex…
-
which type of research would be used if a scientist wanted to know how …
applied
-
which of the following products has the government helped to innovate? …
Air bags, GPS, Personal computer.
-
what was the main reason southern and western politicians supported the…
1. b. To open up land for white settlers 2. a. Cherokee 3. a. To gain access to fertile agricultural land 4. a. The discovery of gold in Georgia 5. d. Cherokee 6. d. 1835 - 1838 7…
-
use the drop - down menus and what you have learned about fossils to co…
The first blank: sediments; the second blank: soft; the third blank: hard.
-
a management consultant to a large transportation company is considerin…
- the company has recently developed partnerships with new subcontractors in its local hubs - the freight of the company is widely varied, as are its destinations
-
which of these transportation scenarios is not related to the impacts o…
Consumers demand that furniture be made locally, causing a drop in the use of carrier services.
-
question # 10 multiple select michael has been hired as a management co…
B. Conduct an assessment of which areas of the company’s sales result in the most on - shelf time for inventory. C. Investigate potential new subcontractors in the local hubs for …
-
question #7 multiple choice of all of the important economic impacts of…
Goods produced internationally may meet different quality standards, fueling a need for more quality control.
-
consider the following events of photosynthesis. 1. light energy excite…
1. photosystem II 2. photosystem II 3. photosystem I
-
which event occurs in photosystem i? water molecules are broken apart. …
Electrons are transferred to ferredoxin.
-
through which conversion is energy released? adp to atp atp to adp nadp…
B. ATP to ADP
-
jasmine and marcus are at the park, and jasmine makes the following sta…
The plant is producing oxygen.
-
during the light - dependent reaction of photosynthesis, light energy i…
chemical
-
how is adp converted to atp? by the addition of one adenosine molecule …
by the addition of one phosphate group
-
along with plants and algae, in which organisms can photosynthesis occu…
some bacteria
-
what is the source of energy that drives photosynthesis? sunlight hydro…
sunlight
-
the diagram summarizes the light - dependent reactions of photosynthesi…
\(H_2O\) and light.
-
which is the site of the light - dependent reactions of photosynthesis?…
thylakoids
-
use the drop - down menus to put the events of the light - dependent re…
1. Light enters the chloroplast. 2. The water molecule is split. 3. Oxygen is released as waste. 4. Electrons are transported from PSII to PSI. 5. ATP and NADPH are produced.
-
sample response: if the electron transport system did not work, electro…
Electrons from PSII would not be transported to PSI, Ferredoxin would have no electrons to transport to NADP⁺, NADPH would not be produced, The light - independent reaction of pho…
-
what would happen if the electron transport system in the light - depen…
ATP and NADPH would not be produced, and oxygen production from water - splitting would also cease.
-
photosynthesis converts light energy to chemical energy. which molecule…
C. ATP and NADPH
-
which corrections would change the diagram to accurately model the ligh…
- \(CO_2\) should be changed to \(H_2O\) - Chemical energy should be changed to light energy - PSII and PSI need to be switched
-
modeling photosynthesis which labels would correctly model photosynthes…
A. Carbon dioxide, B. Light energy, C. Oxygen, D. Glucose, E. Water.
-
which of the following would be an environmental factor that could affe…
temperature of the water
-
gene expression is determined by several factors, including (1 point) s…
chemicals in the body
-
study the equation for photosynthesis. a scientist notices an increase …
- The plant was exposed to more intense light. - The plant absorbed more carbon dioxide.
-
consider the three different types of stem cells. each one’s ability to…
totipotent, pluripotent, multipotent
-
use the information from the equation and table to answer the question.…
3
-
describing photosynthesis analyze the description of photosynthesis. th…
(1) Light energy and chemical energy should be switched; (3) Oxygen should be changed to carbon dioxide; (4) Animals and plants should be switched.
-
which of the following describes when the cell leaves the cell cycle an…
senescence
-
when a stem cell differentiates and changes in size and shape, specific…
expressed.
-
the velocity v of blood at a valve in the heart of a certain animal is …
a. The maximum velocity of the blood at this valve is \(4\) cm/sec and the minimum velocity of the blood at this valve is \(0\) cm/sec. b. The animal's heart rate is \(120\) beats…
-
which is an example of a couplet from shakespeares \sonnet 18\? shall i…
So long as men can breathe or eyes can see, So long lives this, and this gives life to thee.
-
a. liberalism b. klemens von metternich c. coup détat d. bastille e. na…
6. C. coup d'état 7. B. Klemens von Metternich 8. D. Bastille 9. A. liberalism 10. E. nationalism
-
the skyscraper depended on all the following technological innovations …
D. availability of cheaper iron.
-
question 5 of 10 99.9% of the matter that makes up living organisms con…
A. 6
-
social darwinists believed that a religious and scientific worlds shoul…
B. powerful nations were meant to dominate weaker societies.
-
drag each description to the correct location. match each description t…
- Oceanography: "Scientists study the physical and chemical properties of sea waters." and "Scientists observe changes to marine life and aquatic ecosystems." - Geology: "Scientis…
-
activity 2: sketching solutions to inequalities here is a graph that re…
The first cell (\(x - y>5\)) has a dashed line because the inequality is strict (\(>\)). The second cell (\(x - y < 5\)) has a dashed line because the inequality is strict (\(<\))…
-
what was the fate of the texan defenders inside the alamo after the bat…
Santa Anna executed all remaining survivors, including those who surrendered.
-
6. revolutionary leaders in latin america were inspired by * 1 point a.…
- 6. A. the American and French Revolutions. - 7. D. Spain.
-
10. why did the nineteenth century become more secular? * a. people loo…
A. People looked increasingly to science for answers rather than to faith.
-
10. why did the nineteenth century become more secular? * a. people loo…
A. People looked increasingly to science for answers rather than to faith. B. People believed in progress as demonstrated by the Industrial Revolution.
-
6. louis pasteur proposed * 1 point a. the concept of atomic weight. b.…
6. B. the germ theory of disease 7. D. scientific research
-
3. darwins theory of natural selection states that some organisms are m…
True
-
researchers refer to alleles that are involved in polygenic disorders a…
Polygeneic traits are difficult to study and identify genes because they are influenced by multiple genes (not a single gene) and environmental factors. In contrast, single - gene…
-
life scientists are trying to identify the genes involved in polygenic …
Most diseases have a polygenic basis (involve multiple genes). A “one - size - fits - all” approach (standardized drugs and dosages) is not appropriate. Personalized medicine uses…
-
what inventor revolutionized urban growth in the u.s. through his work …
B. Elisha Otis
-
question 25 25. what are the common complications of the birth process?…
failure to progress and breech presentation
-
question 7 of 25 many cell phones vibrate when they receive a call. wha…
D. Electrical energy to kinetic energy
-
determine whether each of the following is a characteristic of a protis…
- Mycelium: Fungi - Heterotrophic: Both - Pseudopods: Protists - Contain cell walls with chitin: Fungi - Fruiting body: Fungi
-
which experiments led to changes to the original cell theory? experimen…
experiments that transplanted synthetic chromosomes into bacterial cells to create a new species
-
which statement is one component of the cell theory? all living and non…
A cell is the basic unit of structure and function of all organisms.
-
which best describes the cell theory? scientists know all there is to k…
As technological advancements are made, the cell theory may change.
-
what process is being shown? how do you know? molecules that move by si…
- **What process is being shown? How do you know?** - Simple diffusion. Molecules move through the lipid bilayer down their concentration gradient. - **In which direction will wat…
-
which structure is found in the cytoplasm of a prokaryotic cell, but is…
None of the options (DNA, ribosomes, nucleus, mitochondria) meet the criteria. Prokaryotic cells have a nucleoid (a region in the cytoplasm with circular DNA) that is not a membra…
-
which type of cells are the least limited in differentiation? adult ste…
embryonic stem cells
-
what role do nerve cells play in the human body? they allow the body to…
They allow the body to react to stimuli.
-
suppose that a patient is diagnosed with a new disease caused by the bu…
lysosome
-
how is mitochondrial dna (mtdna) typing used in forensic science? a sus…
B. A suspect’s mtDNA sample is matched to an unknown sample of mtDNA that was found at a crime scene.
-
in what direction will water move? how do you know?
Water will move from the left side to the right side.
-
paramecium contractile vacuole contractions salt concentration outside …
The bar for very low concentration is twice the height of the bar for medium concentration.
-
which organelles are labeled g? centrioles lysosomes ribosomes mitochon…
ribosomes
-
which organelle makes the proteins that are needed by the cell? cell me…
C. ribosomes
-
the role of the cell membrane is most like the job of which person? a f…
a police officer who allows select people to enter and leave a crime scene
-
type of transport? how do you know?
Type of transport: Active transport. How do you know: Molecules are moving against the concentration gradient (from low to high) and ATP is being used (as indicated by the convers…
-
which is an example of how stem cells are currently being used? for gen…
for directing differentiation to treat diabetes and arthritis
-
which are characteristics of epithelial cells? select two options. are …
C. found lining many areas that contact the external environment, D. plays a role in protection
-
how would the contractile vacuole of a freshwater amoeba respond if the…
with fewer contractions
-
which best defines homeostasis? modifying the external environment main…
maintaining a stable internal environment
-
a scientist is comparing the outer layer of an onion cell to the outer …
It contains cellulose.
-
a scientist discovers a cell that has chloroplasts, cytoplasm, dna, and…
The cell is eukaryotic because it has chloroplasts.
-
what type of solution would cause the cell to swell? why?
A hypotonic solution would cause the cell to swell. This is because in a hypotonic solution, water moves into the cell (by osmosis) as the solute concentration is lower outside th…
-
who first recognized the cell as the universal unit of life? virchow va…
Schleiden and Schwann
-
a magnifying glass is an example of which type of microscope? electron …
simple microscope
-
which organelles are labeled d, and what is one feature that distinguis…
centrioles; found in animal cells but not plant cells
-
the endosymbiotic theory provides an explanation for the origin of chlo…
Chloroplasts have their own DNA.
-
type of transport? how do you know?
Type of transport: Exocytosis. How do you know: Vesicles fuse with the cell membrane to release contents outside, which is the process of exocytosis.
-
which organelle breaks down sugar molecules that supply energy to the c…
mitochondrion