Sovi.AI - AI Math Tutor

Scan to solve math questions

QUESTION IMAGE

question 24 select the correct mrna sequence for this gene (dna): you m…

Question

question 24
select the correct mrna sequence for this gene (dna):
you might need to write out the mrna on paper first, before you select your answer.
(image of dna double helix, chromosome, and dna sequence with options a, b, c, d)
options:
○ a augacggcatcacccgcaattggcgacataaacaag
○ b uacugccguagugggcguuaaccgcuguauuguuc
○ c augacggcactacccgcuattggcacattacgag
○ d atgacggcatcacccgcaattggcgacataaacaag

Explanation:

Step1: Recall Transcription Rules

During transcription, DNA's thymine (T) is replaced by mRNA's uracil (U), and adenine (A) pairs with uracil (U), cytosine (C) pairs with guanine (G), guanine (G) pairs with cytosine (C), and thymine (T) pairs with adenine (A) in DNA - mRNA pairing. The DNA template sequence (the non - coding strand, but here we use the given DNA sequence) is: ATGACGGCATCACCCGC AATTGGCGACATAA CAAG (let's correct the spacing for clarity: ATGACGGCATCACCCGCAATTGGCGACATAA CAAG → ATGACGGCATCACCCGCAATTGGCGACATAA CAAG, actually the full DNA sequence from the diagram is ATGACGGCATCACCCGCAATTGGCGACATAA CAAG? Wait, looking at the options, the DNA sequence in option d is ATGACGGCATCACCCGCAATTGGCGACATAA CAAG. But we need mRNA, so T→U, and the base pairing: A (DNA) → U (mRNA), T (DNA) → A (mRNA), C (DNA) → G (mRNA), G (DNA) → C (mRNA).

Step2: Transcribe the DNA sequence

The DNA sequence is ATGACGGCATCACCCGCAATTGGCGACATAA CAAG. Let's transcribe each base:

  • A → U? Wait no, wait: DNA to mRNA: DNA has A, T, C, G. mRNA has A, U, C, G. So the base - pairing is: DNA A pairs with mRNA U? No, wait, the DNA template strand (the one being transcribed) has bases, and the mRNA is synthesized complementary to it. Wait, actually, the coding strand (the one shown here, since it's the gene) is the non - template strand? Wait, no, during transcription, the RNA polymerase uses the template strand (complementary to the coding strand). But the problem says "gene (DNA)", so we can assume that we are transcribing the given DNA sequence (the one in the diagram, which is the coding strand? Or the template strand? Wait, the DNA sequence in the diagram is ATGACGGCATCACCCGCAATTGGCGACATAA CAAG (the red box is the template? No, the upper strand is ATGACGGCATCACCCGCAATTGGCGACATAA CAAG, the lower red box is TACTGCCGTAGTGGGCGTTAAGGCCTAATGGCCTGTATTGTTG? Wait, no, let's look at the options. Option d is the DNA sequence (has T), so we need to make mRNA from DNA. So replace T with U, and keep A, C, G as is? Wait, no: the base pairing for transcription is: DNA base: A, T, C, G; mRNA base: U, A, G, C. So A (DNA) → U (mRNA)? No, wait, no: the DNA template strand (the one that is read by RNA polymerase) has a base, and the mRNA is complementary. So if the DNA template strand has A, mRNA has U; DNA T → mRNA A; DNA C → mRNA G; DNA G → mRNA C. But if the given DNA is the coding strand (the one with the same sequence as the mRNA except T→U), then we can just replace T with U. Let's check the DNA sequence: the DNA sequence in the diagram (and option d) is ATGACGGCATCACCCGCAATTGGCGACATAA CAAG. So replacing T with U: A U G A C G G C A U C A C C C G C A A U U G G C G A C A U A A C A A G. Let's check option a: AUGACGCAUCACCCGCA AUUGGCGACAUAA CAAG. Wait, let's write the DNA sequence properly: ATGACGGCATCACCCGCAATTGGCGACATAA CAAG. Let's split it: A T G A C G G C A T C A C C C G C A A T T G G C G A C A T A A C A A G. Now transcribe each T to U: A U G A C G G C A U C A C C C G C A A U U G G C G A C A U A A C A A G. Now check option a: AUGACGGCATCACCCGCA AUUGGCGACAUAA CAAG. Wait, option a is AUGACGGCATCACCCGCA AUUGGCGACAUAA CAAG (let's check the letters: AUGACGGCATCACCCGCAATTGGCGACATAA CAAG? Wait, the DNA has "AATTGGCGACATAA CAAG", so transcribing T to U: "AAUUGGCGACAUAA CAAG". Option a is "AUGACGGCATCACCCGCA AUUGGCGACAUAA CAAG" (wait, maybe a typo in the option, but let's check other options. Option b has UAC... which would be complementary to the DNA template strand (if the DNA was the coding strand, option b is complementary, so it's the tRNA or the other strand, not mRNA).…

Answer:

a. AUGACGGCATCACCCGCA AUUGGCGACAUAA CAAG (Note: Assuming the option a is correctly written as AUGACGGCATCACCCGCA AUUGGCGACAUAA CAAG, which is the mRNA sequence obtained by replacing T with U in the given DNA sequence.)