Sovi.AI - AI Math Tutor

Scan to solve math questions

QUESTION IMAGE

period: 5 date: 9-5-2025 dna review quiz 1. what is the structure of dn…

Question

period: 5 date: 9-5-2025
dna review quiz

  1. what is the structure of dna called?
  2. what are the four base pairs of dna?
  3. draw a 20 letter dna template strand and the complementary strand.
  4. what is the function of dna polymerase?
  5. what are the 3 building blocks of dna?
  6. the ______________ is the structure that contains all three building blocks of dna?
  7. dna located in the ______________ of a human cell.
  8. dna located in the ______________ of a bacteria cell.
  9. dna located in the ______________ of a virus.
  10. dna has a ______________ charge.
  11. a section of dna that codes for a protein is called a ______________.

Explanation:

Response
Question 1
Brief Explanations

The structure of DNA is known as a double - helix. This was discovered by Watson and Crick, and it consists of two strands of nucleotides that wind around each other in a spiral shape, held together by hydrogen bonds between complementary base pairs.

Brief Explanations

The four base pairs in DNA are adenine (A), thymine (T), cytosine (C), and guanine (G). Adenine pairs with thymine, and cytosine pairs with guanine, following the base - pairing rules that are fundamental to the structure and function of DNA.

Brief Explanations
  1. First, we choose a 20 - letter DNA template strand. Let's use a random sequence of the four bases (A, T, C, G). For example, the template strand could be: ATGCTAGCTAGCTAGCTAGC
  2. Then, to find the complementary strand, we use the base - pairing rules: A pairs with T, T pairs with A, C pairs with G, and G pairs with C. So the complementary strand for the above template would be: TACGATCGATCGATCGATCG

Answer:

The structure of DNA is called a double - helix.

Question 2