Question

lizard (partial) amino acid sequence... dna sequence...
dolphin amino acid sequence leu-iso-pro-pro-phe-le-leu-leu-ser-arg-val-val-del? dna sequence: ctaatcgccccgtttatcgtactttgcgatgtagtaagt
lion amino acid sequence leu-iso-pro-pro-phe-le-leu-leu-ser-arg-leu-leu-arg dna sequence: ctaatcgccccgtttatcgtactttgcggtctacttcgt
sponge amino acid sequence iso-iso-asp-gln-phe-ile-leu-his-ser-arg-leu-leu-arg dna sequence: attatcgacccagtttatcgtacattcgcgtctacttcgt

cladograms

1. the more amino acids an organism has in common, both in type and order, the closer the relationship between organisms. the same is true for nucleotides (the code for dna). compare the biochemical data above. which organism is most closely related to the lizard? a dolphin
2. why did you choose that organism?

because a dolphin and lizard have the same dna sequence.

1. which organism is most closely related to the dolphin?

a lizard

1. why did you choose that organism?

dolphins and lizards share the same dna sequence

1. how do you think different amino acid sequences would effect organisms? th

Explanation:

Question 3

To determine the organism most closely related to the dolphin, we compare the DNA and amino acid sequences. The lizard and dolphin have very similar (or same, as per the given data) DNA and amino acid sequences, indicating a close evolutionary relationship. Other organisms like the sponge have more divergent sequences.

The key reason is the similarity in DNA (and thus amino acid) sequences. Closely related organisms have more identical or similar nucleotide (DNA) and amino acid sequences. Dolphins and lizards share the same (or highly similar) DNA sequence, so they are closely related.

Amino acid sequences determine the structure and function of proteins. Different amino acid sequences can lead to different protein structures (e.g., altered folding, active sites). This can affect protein function, which in turn impacts cellular processes, traits, and the overall phenotype of the organism. For example, a mutation changing an amino acid in an enzyme's active site might reduce or eliminate its catalytic activity, affecting metabolic pathways.

Answer:

A lizard

Question 4