Question

dna sequences for a number of bird families in the order passeriformes are shown. differences in the dna sequences between the piloris family and other bird families in this order are highlighted in red. an incomplete phylogenetic tree that notes important differences in the dna among these bird families is also shown. use the dna sequence data to complete the phylogenetic tree. move each bird family label into the correct blank box in the phylogenetic tree. based on these dna sequences, which bird family name would you move to empidonax diphyllodes manucodia no answer text provided.

Explanation:

Step1: Analyze the DNA sequences

Compare the DNA sequences of the bird families with the reference (Piloris). Look for specific base - pair changes.

Step2: Check for the \(11 - C\) change

In the Empidonax DNA sequence, at position \(11\), there is a change. The Piloris has \(T\) at position \(11\) (sequence: TCTACTAAAAATCATCAACGACTCC TTAATC), and Empidonax has \(C\) at position \(11\) (sequence: ACTTTAAAAATAGTAATAGACTCTCTAATC).

Step3: Check other families

• Diphyllodes: No \(11 - C\) change. Its sequence at position \(11\) is part of CCTACTAAAAATCGTCAACGACTCCCTAATT.
• Manucodia: No \(11 - C\) change. Its sequence at position \(11\) is part of CTTACTAAAAACCATCAACAACGCCCTAATC.

Answer:

Empidonax