Question

how dna is copied

1. what does it mean that the two strands of dna are complementary?
2. what is dna replication?
3. using your notes, book, and this assignment, place the steps of dna replication in the correct order.

a. the enzyme dna polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand.
b. the dna double helix breaks or unzips down the middle between the base pairs.
c. a complementary strand is created for each of the two strands of the original double helix.
d. two new identical dna molecules have been produced.

1. (true or false) the process of dna replication results in a copy of the original dna molecule.
2. (true or false) dna does not have to break apart to be copied.
3. (true or false) after dna replication is complete, there are two new dna molecules; one molecule has both of the original strands and one molecule has two new strands of dna.
4. where does dna replication happen?
5. when does dna replication happen?
6. below are dna strands. make the complementary dna strand:

original strand: a t g c a a a t t g c t c a c c g g g g g a t c a g c a c c g g
complementary strand:
original strand: a g g g g a t c a g c a c c g g a t t t c a t g a g c c c t a
complementary strand:
original strand: a a g t a c g a t c g a t g c a c a t g c a t g g c t a c g c
complementary strand:
when a cell copies a dna molecule: - color original dna blue + new parts red

1. dna is unzipped. by helicase
2. the complementary bases are added to each template strand. by dna polymerase
3. the 2 new strands are proofread for errors. by dna polymerase and then dna winds up.

Explanation:

• Question 4: In DNA, complementary strands mean that the bases on one strand pair specifically with bases on the other strand (A - T and C - G).
• Question 5: DNA replication is the process by which a cell makes an identical copy of its DNA.
• Question 6: The correct order of DNA replication steps is: b (unzipping), a (adding nucleotides), c (creating complementary strands), d (producing new DNA molecules).
• Question 7: True. DNA replication results in a copy of the original DNA molecule.
• Question 8: False. DNA must unzip (break apart) to be copied.
• Question 9: False. After DNA replication, each new DNA molecule has one original strand and one new strand (semi - conservative replication).
• Question 10: DNA replication occurs in the nucleus (in eukaryotic cells).
• Question 11: DNA replication happens during the S phase of the cell cycle.
• Question 12:
• For the first original strand (ATGCAAATTGCTCACCGGGGATCAGCACCGG):
• A pairs with T, T with A, G with C, and C with G.
• Complementary Strand: TACGTTTAACGAGTGGCCCCTAGTCGTGGCC
• For the second original strand (AGGGGATCAGCACCGGATTTTCATGAGCCCCTA):
• Complementary Strand: TCCCCCTAGTCGTGGCCAAAATGTCTCGGGAT
• For the third original strand (AAGTACGATCGATGCACATGCATGGCTACGC):
• Complementary Strand: TT CATGC TAGCTACGTGTACGT ACCGATGCG

Answer:

• 4. Bases on one strand pair specifically with bases on the other strand (A - T and C - G).
• 5. The process by which a cell makes an identical copy of its DNA.
• 6. b, a, c, d
• 7. True
• 8. False
• 9. False
• 10. In the nucleus (in eukaryotic cells).
• 11. During the S phase of the cell cycle.
• 12.
• TACGTTTAACGAGTGGCCCCTAGTCGTGGCC
• TCCCCCTAGTCGTGGCCAAAATGTCTCGGGAT
• TT CATGC TAGCTACGTGTACGT ACCGATGCG