Biologie
Biologie cellulaire, génétique, écologie et bases des sciences de la vie.
-
various ecosystems, each comprising unique combinations of species and …
B. species diversity
-
some organisms are very specific in where they can live and what they w…
B. Specialists
-
species diversity, genetic diversity, and ecosystem diversity are all p…
A. Biodiversity
-
some organisms are not very specific in where they will live and what t…
B. Generalists
-
question 1 - 14 geologists want to understand why mountains exist in ce…
C. Analyzing land mapping by looking for patterns in land elevation changes
-
part 8 of 9 - analyze the friends consider a block of mass 3.1 kg set i…
A. "The change in internal energy doubles."
-
the end of the french and indian war brings us close to the most import…
1. Revolution means change. 2. The Colonists fought the war against the French and the American Indians. 3. The British treated the colonists as second - rate citizens (or without…
-
the friends consider a block of mass 3.1 kg set in motion by an externa…
$11.3$
-
1. ¿en qué año llegó cristóbal colón a américa? 2. ¿cómo se llamaban la…
1. 1492 2. La Niña, La Pinta y Santa María 3. Encontrar una ruta marítima occidental a las Indias Orientales 4. España 5. Isabel I de Castilla y Fernando II de Aragón 6. 12 de oct…
-
to be eligible for a basketball tournament, a basketball team must win …
11
-
biomedical ethics typically do not address: * 1 poin euthanasia employe…
- First question: B. Employee work schedules - Second question: D. Do Not Resuscitate (DNR) request
-
multiple choice 20 points the once-green football pitch was now a sea o…
The football match has been cancelled due to the weather.
-
multiple choice: choose the best answer and write it in the blank 1 how…
1. A. Drinking contaminated food/water 2. B. Chromoplasts 3. C. Ribosomes 4. D. Overuse of antibiotics 5. A. fecal transplantation 6. D. adaptation 7. B. Increases 8. C. Collectio…
-
many animals, including humans, must sleep, and sleep is known to have …
A. prolonged deep sleep is likely advantageous in ways that have yet to be discovered.
-
review! thinking back to unit 2, what happens to excess sugar produced …
It is stored as starch.
-
based on the observation of a puddle on the sidewalk, which of the foll…
1. It must have rained recently. 2. If the temperature is increased, then the rate of bacterial growth will increase. 3. The availability of this specific grass influences the nes…
-
a scientist observes that plants near a factory are growing slower than…
- First question: Increased exposure to factory emissions inhibits plant growth. - Second question: The solution turned blue after the two liquids were mixed. - Third question: Th…
-
why do plants make sugars from sunlight instead of just using atp direc…
ATP is not very stable for long - term storage and is used quickly after it is made.
-
a hypothesis states if the amount of fertilizer is increased, then the …
1. It can be tested through experimentation and potentially shown to be false. 2. The leaves on the plant are wilting. 3. A logical conclusion or interpretation based on observati…
-
question 1 - 10 a scientist discovers a fossil that challenges the curr…
Consider revising existing theories to include the new evidence.
-
a hypothesis states: if the amount of fertilizer is increased, then the…
It can be tested through experimentation and potentially shown to be false. ### Second Question
-
which of the following does not occur during photosynthesis? (1 point) …
Oxygen is used to make carbon dioxide
-
a scientist hypothesizes that increased carbon dioxide levels will lead…
1. Grow two groups of the same plant species, one with normal carbon dioxide levels and one with increased levels, and compare their growth. 2. A tentative explanation for an obse…
-
edith clarke (1883 - 1959) (excerpt) 1 born in the nineteenth century w…
"Unfortunately, she was unable to find an engineering position, so she settled in at General Electric (GE) as a 'computor.' There she worked in a separate women's division within …
-
edith clarke (1883 - 1959) (excerpt) 1 bom in the nineteenth century wh…
D. "She was the first woman to earn professional standing in Tau Beta Pi, the nation's largest and oldest electrical engineering fraternity." (paragraph 7)
-
a student sees a puddle on the sidewalk after it rained. this is an exa…
- First question: An observation. - Second question: Observation. - Third question: The dinosaur likely had three toes.
-
which structure of a plant controls the rate of photosynthesis? (1 poin…
Leaves
-
where does the water for photosynthesis come from? (1 point) the leaves…
the roots of the plant
-
what is the original source of energy in our biosphere (the earth)? (1 …
the sun
-
identify the organelle where photosynthesis takes place. (1 point) nucl…
Chloroplast
-
for the values listed in the table, i represents the imaginary unit. se…
The cells corresponding to \(i\times i^{5}\) and \(i^{2}\times i^{4}\)
-
which of the following was part of hamiltons plan to handle the nationa…
Raise tariffs to encourage Americans to buy American - made products.
-
why was america in debt after the revolutionary war? they had just boug…
they owed money to countries like France and Spain
-
communication arts 400 macbeth act 3 reading questions after completing…
1. Macbeth is thinking about the prophecy that Banquo's descendants will be kings. He is also worried about being caught and losing his power. 2. Before killing King Duncan, Macbe…
-
question 1 - 2 scientists study many different types of questions, from…
B. Each field has unique questions and phenomena that require specific techniques
-
the table shows several complex numbers where / is the imaginary unit. …
The cells corresponding to \((8 + 2i)\times(8 - 2i)\), \(5i\times i\), \(-4\times3\) should be selected.
-
reading check section 5 - revolutions in latin america napoleons french…
B. false
-
21. cellular respiration has two parts, aerobic and anaerobic. what doe…
21. Aerobic needs oxygen, makes more ATP; anaerobic no oxygen, less ATP. 22. Alcoholic fermentation and lactic acid fermentation. 23. Lactic acid fermentation. 24. Alcoholic ferme…
-
dictionary puzzle #2 1. put the following words into alphabetical order…
1. basket, cocoa, diary, dynamite, domino, dwarf, frail, guard, inflate, kidnap, pillow, pinafore, program, scrap, scuff 2. algae 3. chicken 4. loess (it's a geological term, othe…
-
5. if a parent cell has 26 chromosomes, how many chromosomes will there…
5. a. 26 chromosomes b. 13 chromosomes 6. a. 58 chromosomes b. 29 chromosomes 7. a. 8 chromosomes b. 4 chromosomes 11. Diploid 12. Haploid 13. Diploid (in most cases for the conte…
-
question 19 2.5 pts mark twain labeled the industrial era in the united…
- Question 19: Extremes of wealth and poverty - Question 20: The Transcontinental Railroad.
-
based on the pictures below, indicate the process and include a brief d…
- Top - left: Mitosis (a cell division for growth with same chromosome number in daughter cells) - Top - right: Sexual Reproduction/Fertilization (sperm - egg union to form zygote…
-
what molecule that is created during photosynthesis provides energy for…
glucose
-
mitochondria: what organism is this found and what process occurs here?…
12. Autotrophic organisms (plants, some algae, certain bacteria). 13. All living organisms. 14. Photosynthesis: chloroplasts (in plants/algae); Cellular respiration: mitochondria …
-
what reactants, or starting materials, does a plant need to create a gl…
water, sunlight, carbon dioxide
-
which statement is true of chloroplasts? they convert light energy into…
They convert light energy into chemical energy.
-
why do the cells in all living things need energy? so they can block su…
to fuel their chemical reactions
-
17. a cell going through the cell cycle that failed to complete dna rep…
17. \(G_2\) checkpoint 18. \(G_1\) checkpoint 19. Enters \(G_0\) phase.
-
requirement 1. journalize the transactions (omit explanations) open t -…
|Date|Accounts|Debit|Credit| |---|---|---|---| |December 31|Accounts Receivable|$410,000| | | |Sales Revenue| |$410,000|
-
what is an organism that carries and transmits pathogens to humans or o…
Vector
-
what kind of pathogen causes the disease called athletes foot? fungi ba…
Fungi
-
single - celled microorganisms that live almost everywhere on the earth…
Toxin: A substance that kills cells or interferes with their function. Bacteria: Single - celled microorganisms that live almost everywhere on the earth. Virus: A piece of genetic…
-
how would you describe the growth rate of a pyramid with a broad base? …
A rapidly expanding population
-
30. soaps and detergents are able to remove oil, grease, etc from items…
- 30. a. hydrophobic; water - 31. b. liquid, solid - 32. c. lipids - 33. d. dehydration synthesis - 34. a. primary - 35. nitrogenous bases; uracil; thymine
-
1. true or false: a marine food web represents a linear path of energy …
1. False 2. True 3. False 4. True 5. True 6. False 7. True 8. False 9. True 10. True
-
27. fatty acids contain - hydrogen bonds, making them. the phosphate \h…
27. a. carbon; hydrophobic; hydrophilic; amphiphilic 28. b. triglyceride; glycerol, fatty acids 29. c. unsaturated; double; saturated; single
-
22. nucleic acids, such as rna, consist of monomers of ____________. ea…
- 22. c - 23. c - 24. d - 25. c - 26. b
-
match the words with the corresponding definition emigration immigratio…
- Emigration: Organisms "EXITING" the population - Immigration: Organisms coming "IN" to the population - Limiting Factors: Factors that control the size of a population such as r…
-
the process modeled above shows dna replication. which phase does this …
S - Phase
-
1. what is the primary role of primary producers in a marine food web? …
1. B. To capture solar energy and produce food 2. C. Small fish that eat zooplankton 3. A. Tertiary consumers 4. D. Decomposers 5. D. Collapse of fish populations
-
select the part of the dna molecule that codes for our traits.
The nitrogenous base (the arrow - shaped part in the diagram) is the part of the DNA molecule that codes for our traits.
-
translation practice directions: read each sequence of rna and translat…
First mRNA amino - acid sequence: Met, Tyr, Pro, Lys, Ala, Ala Second mRNA amino - acid sequence: Met, Glu, Ala, His, Phe, Gly Third mRNA amino - acid sequence: Met, Leu, Thr, Ala…
-
11. when proteins are formed the ___ of one amino acid combines with th…
11. d. amino group; carboxyl group; polypeptide 12. d. the side chains can vary 13. a. shape is driven by chemistry; shape dictates function 14. b. tertiary 15. b. the protein los…
-
complex organisms quick check which correctly describes sister chromati…
They are part of the lined - up chromosomes in mitosis.
-
complex organisms quick check which type of stem cell is able to differ…
totipotent cells
-
complex organisms quick check in what phase of mitosis do chromosomes s…
anaphase
-
role 1. removes the rna primer 2. extends the dna chain 3. makes the rn…
1. g) DNA polymerase I 2. e) DNA polymerase III 3. c) RNA primase 4. f) Ligase 5. a) Helicase 6. b) Gyrase 7. d) SSB proteins
-
match the words with the corresponding definition clumped distribution …
Clumped Distribution: Organisms are clustered in groups Random Distribution: Organisms have no pattern Uniform Distribution: Organisms are spaced out at equal distances Pattern of…
-
complex organisms quick check which of the following correctly orders e…
The nuclear membrane dissolves. The mitotic spindle attaches to chromosomes. Microtubules organize the chromosomes.
-
indicate the phase where each of the following events occur. type in th…
- Chromosomes line up along the equator: Metaphase - Cytokinesis begins, two daughter cells form: Telophase - DNA makes a copy, cell prepares for division: Interphase - Nuclear me…
-
complex organisms quick check in which phase do cells rest? (1 point) a…
interphase
-
4. what is the minimum internal temperature for baked goods with eggs t…
\(165^{\circ}F\)
-
6. identify the process shown in the illustration below: a. combustion …
6. d. hydrolysis 7. a. Two monomers 8. c. each protein is an arrangement of monomers in a unique manner 9. d. dehydration synthesis 10. b. \(NH_3 - COOH -\) side chain
-
5. what are the functions of the following organelles? what cell will t…
- Nucleus: Function - stores DNA, controls cell activities. Cell type - both. - Mitochondria: Function - energy production (ATP). Cell type - both. - Golgi apparatus: Function - m…
-
12. below are dna strands. make the complementary dna strand: original …
Complementary Strand 1: TACGTTTAACGAGTGGCCCCCTAGTCGTGGCCG Complementary Strand 2: TCCCCCTAGTCGTGGGCCAAAATGTCTCGGGGA T Complementary Strand 3: TTCA TGC TAGCTACGTGTACGTACCGATGCCG
-
11. when does dna replication happen?
DNA replication happens during the S phase of the cell cycle.
-
requirement 1. journalize the transactions. ignore cost of goods sold. …
| Date | Accounts | Debit | Credit | | ---- | ---- | ---- | ---- | | Jan 1 | Accounts Receivable | $1,460$ | | | | Sales Revenue | | $1,460$ |
-
as marine researcher william watkins listened to the sounds of the sea,…
C. Scientists heard a whale call with an unusual pitch, but they haven't discovered its source yet.
-
name: date: part i: multiple choice (write the letter of the correct an…
1. B. Seven Years’ War 2. C. France and Britain 3. A. Pontiac 4. B. Competition over trade routes and land 5. B. The Ohio River Valley
-
5. using your notes, book, and this assignment, place the steps of dna …
5. b, a, c, d 7. True 8. False 9. False
-
why does the author end the text by saying that the whale songremains o…
B. To point out that the ocean is full of secrets like this one
-
question 4 of 6 4 scientists have several theories to explain the 52 he…
It could be a blend or hybrid of two different whale species; It is a whale with a physical difference affecting its voice.
-
as marine researcher william watkins listened to the sounds of the sea,…
C. No other animal ever responded to its song
-
as marine researcher william watkins listened to the sounds of the sea,…
A. The sound doesn't travel far, so other whales might not hear it.
-
as marine researcher william watkins listened to the sounds of the sea,…
frequency; higher
-
how dna is copied 4. what does it mean that the two strands of dna are …
4. It means that the bases on one strand of DNA pair specifically with bases on the other strand (A - T and C - G), allowing each strand to act as a template for the synthesis of …
-
5. read the following passage and answer the following question: \in 18…
Without Cyrus McCormick, Chicago wouldn't have developed at the same rate.
-
included in one day at a time: manry farber and termite art, a 2018 gro…
B. race, gender, history.
-
question 10 which of the following is an example of a secondary source?…
A scholarly article published in an academic journal about the Mongol Empire.
-
question 8 the clergymen write: \we do not believe that these days of n…
Understatement (meiosis) - minimizing the urgency of protests to make them seem unnecessary.
-
base your answer to questions 12 and 13 on the image and on your knowle…
12. 2) 13. 1)
-
23. impuesto que debe pagarse sobre una clase particular de importacion…
23. A. Arancel 24. D. Embargo
-
part i: multiple choice (write the letter of the correct answer. each i…
1. B. Seven Years' War 2. C. France and Britain 3. A. Pontiac 4. B. Competition over trade routes and land 5. B. The Ohio River Valley
-
answer all questions in this part. directions (9 - 25): for each statem…
9. 1. Many Irish chose to emigrate to North America. 10. 3. farming methods that promoted the spread of the potato fungus 11. 1. Enlightenment ideas of natural rights, 2. The Cong…
-
10. el acto o proceso de gobernarse a sí mismo; un estado de ser autogo…
C. Autogobierno
-
the alabee tree is one of many forest plant species native to the hawai…
A. Without birds like the red - vented bulbul, *alahe*e trees and other native forest plants would be at even greater risk of extinction.
-
why do african wildcats purr but leopards roar? researchers hypothesize…
B. The text poses a question about two species, then presents a possible answer.
-
given that the organizers specifically ____ that the conference was int…
B. stipulated
-
in organizing the events of odysseuss quest, why would the text in the …
It shows Odysseus encountering supernatural beings.
-
before the 1858 publication of on the origin of species, charles darwin…
C. sometime in or before October 1838, Darwin determined that a postulate rooted in economics might also be applicable to biology.