Biología
Biología celular, genética, ecología y fundamentos de ciencias de la vida.
-
in rabbits, black fur (b) is dominant over brown fur (b). if a rabbit h…
It is bb.
-
in a punnett square, a lower case letter stands for a --------- allele.…
recessive
-
4. what phase of mitosis, when complete, will result in two identical n…
Telophase
-
pick a word use the words in the box below to complete each statement. …
### Pick a Word Answers: 1. guide sign (provides route, service, interest info) 2. regulatory sign (informs of must - obey laws) 3. minimum speed limit (keeps traffic moving on hi…
-
some flowers are controlled by codominance. red flowers (rr), blue flow…
2 red, 2 speckled
-
3. if you were looking at a cell that had all of its chromosomes lined …
Metaphase
-
2. which of these does not occur during mitosis? separation of chromati…
Division of the cytoplasm
-
les composantes du système technologique dune éolienne décrivez la fonc…
To solve this, we analyze each component of a wind turbine (éolienne) and describe its function: ### 1. Pales (Blades) - **Function**: Capture the kinetic energy of the wind (éner…
-
1. during what phase of mitosis do the sister chromatids separate? anap…
Anaphase
-
1. cytokinesis in results in the formation of a cell plate between the …
First blank: plant cells Second blank: animal cells
-
1. circle true or false. in the anatomical position, the body is recumb…
1. False 2. b. toward or at the body surface 3. b. sagittal
-
exploring mitosis 1. during the cell cycle, the cell divides its nucleu…
1. During the cell cycle, the cell divides its nucleus and chromosomes during **mitosis**. 2. The cytoplasm and cell membrane divide during **cytokinesis**. 3. Before the cell can…
-
what type of inheritance do two alleles have if they traits blend toget…
Incomplete Dominance
-
one form of a gene is called ______ options: a trait, a phenotype, a dn…
an allele
-
the limbic system __________ ah-mig-dah-la - neural clusters that are c…
Top section (Amygdala): 1. First blank: Amygdala 2. Second blank: emotion/fear responses 3. Third blank: Hippocampus 4. Fourth blank: Spatial 5. Fifth blank: Memory Bottom section…
-
this punnett square shows a cross between two hybrid parents a heterozy…
Two homozygous parents
-
¿quiénes eran los poderosos líderes que gobernaron israel antes de los …
O jueces
-
hair color, height, eye color and freckles are examples of human traits…
phenotype
-
which of the following genotypes is homozygous dominant?
YY (the orange option)
-
if you cross a black guinea pig with a white guinea pig and the offspri…
incomplete dominance
-
incomplete dominance means that the traits are expressed equally recess…
blended
-
cross aa × aa what is the genotypic ratio of the offspring? (options: 2…
1:2:1
-
heterozygous is when... the alleles are different. the alleles are abse…
the alleles are different.
-
at this preparation level, which tool or feature could help you improve…
C. Keep a digital journal and update it during breaks.
-
when one allele is not dominant over the other, resulting in both trait…
Codominance
-
in animals, shaggy fur is dominant to short fur. the punnett square sho…
Ff and ff
-
cross: aa × aa what are the phenotype percentages of the offspring? (a …
75 % Brown fur and 25% White fur
-
in pea plants, the tall allele is dominant to the short allele. what ke…
Tall = T, Short = t
-
the respiratory system directions: read the passage about the digestive…
1. The respiratory system is the body system that exchanges gases with the outside air; it brings oxygen-containing air into the body for cells and releases carbon dioxide from ce…
-
having two of the same genes for the trait (sometimes called purebred) …
homozygous
-
if green is dominant over purple, then what is the genotype for this in…
gg
-
the brain: midbrain - - neurotransmitter - - superior - receives input …
- I: Substantia nigra - Neurotransmitter: Dopamine - Associated function: Motor control (movement regulation) - Superior: Colliculus
-
structure of dna: the double helix label this diagram, showing part of …
- Box pointing to dashed lines: **Hydrogen Bonds** - Box pointing to sugar-phosphate link: **Sugar-Phosphate Backbone** - Additional labels: - Blue circles: Phosphate Group - Red/…
-
1. it was a profound book that analyzed the role of envy in different t…
B. intellectual and thoughtful ### Question 2
-
multiple choice question behavior is produced by complex interactions a…
C. brain.
-
multiple choice question the ______ division of the peripheral nervous …
A. autonomic
-
hormones secreted directly by the pituitary gland control sexual urges.…
C. growth
-
name: ______ date: ______ directions: read this passage three times, on…
This appears to be a reading fluency activity where students read the passage "Reindeer" three times on different days, time themselves, count the number of words read correctly, …
-
the brain: hindbrain - hindbrain - ______________ - medulla - pons - __…
Top card: - First blank (Hindbrain structure): Cerebellum - Second blank (coordinate muscle movement): voluntary - Third blank (maintenance of): balance (or equilibrium) - Fourth …
-
1. what are two adjectives that describe the song’s mood? spirited, con…
Two adjectives describing the song’s mood are spirited and courageous. ### Question 2:
-
in 1979, bones found outside ekaterinburg, russia, were shown to be tho…
1. Correct options for why mtDNA was used: - Mitochondrial genomes are present in multiple copies in the cells. - Mitochondrial DNA does not undergo recombination. - Mitochondrial…
-
dna 1 agttactaaagcaatacatc tcaatgattttgttatgtag dna 2 aggcgggtaggcaccct…
DNA 1 because it has a lower percentage of G-C base pairs that stabilize DNA duplexes
-
question 2 (13 points) the path to industrialization began when the com…
To solve this fill - in - the - blank question about the Industrial Revolution, we analyze each blank based on historical knowledge: ### Blank 2 The first part of the passage is a…
-
question 5 of 13 during mammalian fertilization, two haploid gamete cel…
two sets of chromosomes.
-
scenario: a large lake is surrounded by land during a hot summer day. a…
C. Evaporation
-
think about it - as geneticists in the early 1900s applied mendel’s law…
### THINK ABOUT IT - As geneticists in the early 1900s applied Mendel's laws, they wondered where **genes** might be **located in the cell**. - They expected genes to be carried o…
-
the cunning swallowtail caterpillar also uses color to lie to predators…
A. This completes your training at the Animal Defense Academy. Whether you run, wear armor, stink, or lie, do your best to stay alive.
-
euchromatin both heterochromatin answer bank is found in prokaryotes ha…
## Euchromatin: - has a high level of transcription - is the major state of most genes - is loosely packed ## Both: - is a state of DNA organization ## Heterochromatin: - has a lo…
-
brain communication __________ part - neurons are separated by a space …
1. Synaptic 2. synapse 3. Neurotransmitters 4. Acetylcholine (example; Dopamine/Serotonin are also acceptable)
-
mitochondria only chloroplasts only both mitochondria and chloroplasts …
## Mitochondria only perform cellular respiration, found in animals ## Chloroplasts only perform photosynthesis, contain grana ## Both mitochondria and chloroplasts contain DNA, m…
-
select all statements that accurately describe the structures or functi…
- Mitochondria regulate apoptosis. - The synthesis of adenosine triphosphate, ATP, occurs inside the mitochondria.
-
brain communication __________ part - neurons are separated by a space …
- First blank (space between neurons): synapse - Second blank (NT): Neurotransmitters - Third blank (example): Serotonin (or Dopamine, Acetylcholine; all are valid examples)
-
answer bank divergence of early eukaryotes occurred undigested bacteria…
- Box connected to the cell with orange organelle (after "Host cell ingested aerobic bacteria."): Undigested bacteria evolved into mitochondria. - Box connected to the cell with b…
-
fulmar birds leave their chicks alone in the nest while the parents hun…
looks
-
part 5: imagine youre there imagine it is the year 1941, and you are a …
December 1941 Dear Journal, The world feels so scary right now. Europe is at war, and just last month, Japan attacked Pearl Harbor—now America is in the war too! Everywhere, peopl…
-
i - ready if something bothers the bombardier beetle, it sprays out a b…
C. These animals make themselves taste or smell bad so that predators stay away.
-
if something bothers the bombardier beetle, it sprays out a boiling hot…
The subfield is Biology (from Natural Science discipline).
-
poison or stink another great defense is to make yourself taste or smel…
hot
-
multiple-choice question when an atom is neutral... the electrons and p…
the electrons and protons are equal
-
3. what are the two classifications of vitamins that humans need? water…
water-soluble and fat-soluble
-
2. what is another name for the category of nutrients that includes fat…
lipids
-
in part 2, chapter 5, winstons discussion with julia of jones, aaronson…
B. Winston fears that he cannot keep hold of his memories and his own private history
-
1. how do \essential\ amino acids differ from other amino acids? the hu…
The human body cannot make essential amino acids.
-
answer bank un digested bacteria evolved into mitochondria. divergence …
- Bottom left box (first step): Host cell ingested aerobic bacteria. - Box connected to the cell with mitochondria: Undigested bacteria evolved into mitochondria. - Middle right b…
-
Question was provided via image upload.
- Top blank: **Neuron** - "In the form of" blank: **electrical and chemical signals** - "An" blank: **action potential** - "1st received by a neuron's" blank: **dendrites** - "Tra…
-
rotation 1 homologous structures are those parts of an organism which h…
The frog foot and bat wing are homologous structures because they have a similar anatomical (bone) structure, indicating they evolved from a common ancestor, even though they have…
-
fill in the blanks to compare and contrast puffer fish, hedgehogs, and …
1. For the puffer fish blank: larger 2. For the hedgehog blank: curl
-
within a neuron, messages travel in a(n) ______ form. static chemical l…
D. electrical
-
brain communication - - part: - information is communicated throughout …
1. Brain Communication 2. Electrical; action potentials (or nerve impulses) 3. Chemical; neurotransmitters
-
text structures, part 1 — instruction — level d day they look like larg…
For the first blank (puffer fish's defense - related description): wetter For the second blank (pangolin's action): curl
-
6. according to greek mythology, which god or goddess stopped growing t…
B. Demeter
-
perform only three tasks ______ information from other neurons ______ i…
1. Receive information from other neurons 2. Conduct information down its length 3. Transmit information to next neuron in line
-
ready they look like large spiky balls that would be impossible to swal…
- First blank (protective parts location): outside - For the part "while ____ and pangolins ____ themselves into a ball": hedgehogs; curl (or roll, but "curl" is more accurate for…
-
1. in your own words describe what an amoeba is a single - celled eukar…
An amoeba is a single - celled eukaryotic organism. It has no fixed shape, can form pseudopodia to move and capture food (like bacteria) via phagocytosis, lives in moist/aquatic h…
-
brain anatomy - the brain is made up of - ~86 to ~100 billion nerve cel…
- ~86 to ~100 billion nerve cells (called **neurons**) and - Ten times as many **support** cells (called **glial cells**) - Physical support for **neurons** and **blood vessels** …
-
use spines or armor if you can’t run away, a nice suit of spines or arm…
A. impossible
-
nervous system - the body’s speedy, electrochemical communication syste…
- **Sensory neurons**: input to the **brain/spinal cord (central nervous system)** - **Motor neurons**: output from the brain/spinal cord to **muscles and glands** - **Interneuron…
-
florence et olivier sont deux adolescents âgés de 17 ans. ils sortent e…
a) Un être humain devient fertile à la puberté : pour une fille, entre 10 et 14 ans (début de l'ovulation) ; pour un garçon, entre 12 et 16 ans (début de la production de spermato…
-
text structures, part 1 — instruction — level d the first line of defen…
away
-
Question was provided via image upload.
1. **Autonomic** Nervous System - The part of the peripheral NS - Controls the glands and the muscles of the internal organs (i.e. heart) 2. **Sympathetic** Nervous System - Divis…
-
multiple choice question which of the following is a common excitatory …
A. Glutamate
-
the two parts of the central nervous system are the: cortex and core ar…
C. brain and spinal cord
-
build me a prokaryotic cell cell wall chloroplast cell membrane vacuole…
The components of a prokaryotic cell from the given options are: Cell Wall, Cell Membrane, Ribosomes. The other structures (Golgi Apparatus, Endoplasmic Reticulum, Centriole, Chlo…
-
problem a this table shows the radiuses of four cones with a height of …
| Radius (m) | Volume (cu. m) | |------------|----------------| | 1 | \( 6\pi\approx18.84 \) | | 2 | \( 24\pi\approx75.36 \) | | 3 | \( 54\pi\approx169.56 \) | | 4 | \( 96\pi\appr…
-
question 4 (multiple choice worth 3 points) (06.07 mc) which of the fol…
A. First trimester—tissues and organs form; amniotic sac forms; neurulation occurs ### Question 5
-
please refer to the passage to help you answer the problem. what do the…
A. large molecules
-
read the two passages. passage 1 violence in video games is unavoidable…
Passage 2 is more effective because it contains logical and anecdotal, while passage 1 contains a bandwagon appeal and a false dilemma.
-
read the text. a biological toilet, or composting toilet, isnt hooked u…
sequential
-
read the passages, listen to the audio clip, and then choose the best a…
To solve this, we analyze each statement against Passage 1 ("Blast Off!") and assume Passage 3 (not fully visible, but we use Passage 1's content): ### 1. "Explains the difficulty…
-
what type of alternative energy directly uses the sun to produce energy…
solar energy
-
33. which japanese player won the afc asian international player of the…
A. Keisuke Honda
-
which choices are examples of self - governance during the period of sa…
A. town meetings D. House of Burgesses
-
multiple choice question neurotransmitters are released by a neurons __…
B. terminal button
-
true or false question not all neurons are capable of receiving the che…
A. True
-
question 2 (multiple choice worth 3 points) (06.07 mc) the connection b…
C. placenta ### Question 3
-
exit ticket in november 2016, a new vaccine against hiv was tested in s…
Most people with HIV do not die from the virus itself because HIV primarily attacks the immune system (specifically CD4+ T - cells), weakening it over time. The direct lethal effe…
-
which of the following are classified as supportive connective tissues?…
B. Bone, C. Cartilage
-
identify which statements about connective tissue are accurate. (check …
- Forms bones, cartilage, ligaments, and tendons - Forms deep layers of skin (dermis) - Forms a structural framework for organs
-
the presence of cilia on an epithelial tissues apical surface indicates…
The statement is false.
-
which of the following is/are released by a neurons terminal buttons in…
Neurotransmitters (the option with the blue circle, labeled "Neurotransmitters")