Biología
Biología celular, genética, ecología y fundamentos de ciencias de la vida.
-
most states had serious economic problems under the articles of confede…
Cause 1: Congress did not have the power to raise taxes, so it could not afford to pay the army. Effect 1: Some former soldiers like Daniel Shays were angry that they were not pai…
-
what does the decline of the songhai empire reveal about the challenges…
B. Internal political divisions made empires vulnerable to external threats
-
what is the purpose of testing distilled water in tube 3? to eliminate …
To eliminate the possibility that the water portion of the potato and onion solutions causes a positive result.
-
how did askia muhammad is administrative reforms contribute to the song…
He created a balance between central authority and local autonomy
-
isle royale national park in michigan has a problem. in 2009, twenty - …
C. decreasing
-
which solution is the positive control? distilled water starch solution…
C. Glucose solution
-
role in soil formation, water purification, air purification, nutrient …
living and nonliving entities in a specific area
-
description: large areas of forest are cleared for agriculture, logging…
- ¿Cuál es la esfera que es impactada primero? La biósfera. - ¿Cómo cambia la deforestación la atmósfera y el hidrosfera? En la atmósfera, reduce la absorción de dióxido de carbon…
-
match the writings with each of the philosophers. john locke thomas hob…
John Locke - Two Treatises of Government Thomas Hobbes - Leviathon Jean Jacque Rousseau - No book title, just journals (this is an incorrect match as he has well - known books but…
-
introduction to enzymes lab background information: enzymes are protein…
1. Optimal; 98.6; 37; denature 2. Neutral; 7; stomach
-
positive feedback loops can drive a system to extremes, while negative …
Negative
-
quiz question 1 of 8 alida works from home. which item is a want for he…
D. Streaming service
-
3. what happened to the number of cells when you changed the persons he…
Typically, a taller person has more cells than a shorter person due to the need to build and maintain a larger body structure, but other factors can influence this relationship.
-
which of these sentences uses quotation marks and other punctuation cor…
"Can I get a new cell phone?" wondered Petra, "while I still have three months left on my old contract?"
-
of corn, every head of wheat sown by sweat and hands, hands gleaning co…
It represents the different types of purposeful labor people do on the land.
-
1. a. click on enter or edit dna and copy this code: atgccagggcggagagct…
1. First, change the 4th base of the DNA sequence ATGGCAGGGCGGAGAGCTAA to G, getting ATGGCGGGGCGGAGAGCTAA. 2. Then, proceed through the steps of transcription and translation usin…
-
2. what did you notice about the rate of cell division in the different…
Different cell types have different rates of cell division, influenced by factors such as function, location, and tissue needs.
-
unicellular organisms can be prokaryotic or eukaryotic, but all complex…
A cell lives in a boiling hot spring. It uses chemicals like sulfur for energy instead of sunlight or food. Its DNA floats freely inside of its cytoplasm: Prokaryotic A cell lives…
-
a prokaryotic cell and a eukaryotic cell are shown. which characteristi…
The organization of the genetic material
-
historically, the product - life - cycle theory is an: a. accurate expl…
B. accurate explanation of international trade patterns in some countries but not in others
-
historically, the product - life - cycle theory is an: a. accurate expl…
B. accurate explanation of international trade patterns in some countries but not in others
-
name the 3 scientists that played a major role in the development of ce…
Matthias Schleiden, Theodor Schwann, Rudolf Virchow
-
which result is most likely if enzymes are exposed to very high tempera…
First question: Enzymes will denature and be unable to function. Second question: Enzymes lower the activation energy of a chemical reaction.
-
which of the following biomolecules is primarily used by the body for l…
1. Lipids 2. It is a type of protein that speeds up chemical reactions
-
this is a system of measurement that is also called si units * internat…
International System of units
-
1. how did the different cell types in the simulation come to be?
They likely came to be through programming based on biological models of cell - differentiation processes such as gene expression, signaling pathways, and environmental cues that …
-
match the following biomolecules with their function. lipids choose car…
Lipids: Fats and oils that store energy and help form cell membranes. Carbohydrates: Sugars and starches that provide quick energy for cells. Nucleic Acids: (No full - correct opt…
-
select the tubes that contain protein. select all that apply. tube 1: p…
Tube 1: Pepsin, Tube 2: Albumin
-
identify the stages of mitosis review the stages of mitosis metaphase a…
From top to bottom: Telophase, Anaphase, Prophase, Metaphase, Prometaphase
-
read the section on prokaryotes and eukaryotes to identify the similari…
| Cell type | Cell size | Nucleus | Complexity | Example of organism with this cell type | |--|--|--|--|--| | Prokaryotic Cell | smaller | no | less complex | Bacteria | | Eukaryo…
-
a group of scientists introduced 64 birds into a wildlife sanctuary and…
729
-
multiple - choice question cancer is essentially just cell death sick c…
Uncontrolled Cell Growth
-
this is a system of measurement that is also called si units * your ans…
International System of Units
-
which solution is the negative control? distilled water albumin pepsin …
Distilled water
-
what happens in cytokinesis? the cell prepares to split again. the cell…
The cells splits into two.
-
in telophase... the chromosomes condense two new nuclei form with 46 ch…
two new nuclei form with 46 chromosomes each
-
in anaphase... two new nuclei form chromosomes split apart chromosomes …
chromosomes split apart
-
in metaphase... chromosomes split apart chromosomes condense chromosome…
chromosomes line up in the middle
-
6173 - 3: 2025 - sep - 10wk - mm: international business manager wk - m…
True
-
in prophase.... chromosomes line up in the middle chromosomes split apa…
chromosomes condense
-
173 - 3: 2025 - sep - 10wk - mm: international business ma - mm time le…
A. voluntary export restraint
-
what occurs during anaphase? the cell divides into two new cells. centr…
Chromosomes are pulled to opposite sides of the cell.
-
mm6173 - 3: 2025 - sep - 10wk - mm: international business 10wk - mm qu…
C. To protect domestic producers from "unfair" foreign competition
-
root words karyo comes from the greek karyon, meaning ut\ or \kernel.\ …
A membrane - bound nucleus.
-
reading tool compare and contrast transmission and scanning electron mi…
TEM images are 2 - D cross - sections of thin samples, while SEM images are 3 - D surface - detailed images.
-
question 13 (08.01 mc) a biologist created the following graph to show …
The number of larvae is greatest at 5 degrees Celsius.
-
what occurs during metaphase? the chromosomes line up in the middle of …
The chromosomes line up in the middle of the cell.
-
prokaryotes and eukaryotes q. key question how do prokaryotic and eukar…
| | Prokaryotic Cell | Eukaryotic Cell | |--|--|--| | Cell membrane | yes | yes | | Nucleus | no | yes | | Cell size | smaller | larger | | Complexity | simpler | more complex | |…
-
which of the following occur during prophase? check all that apply. nuc…
Nucleus is present.
-
1. reading check how did observations of the natural world bring change…
Observations of the natural world in Italy led to more realistic and detailed art, with artists studying nature to improve techniques like anatomy, perspective, and light - shadow…
-
true or false? a chromosome and chromatid are the same thing. false tru…
False
-
mm6173 - 3: 2025 - sep - 10wk - mm: international business manag 0wk - …
A. Smoot - Hawley Act
-
why should we duplicate the chromosomes before mitosis? so each new dau…
So each new daughter cell has the exact number of chromosomes as the parent cell
-
read this portion of an outline from a passage. 1. organic produce a. o…
point - by - point comparison
-
the total number of public electric charging units available for hybrid…
46272
-
2023 - sep - 10wk - mm: international business manag time left 0:28:12 …
c. goods are being sold at below their cost of production or goods are being sold at below their "fair" market value
-
chromosomes contain what materials? select all that apply: dna proteins…
DNA, Proteins
-
what types of events occur during interphase? choose all that apply! di…
Carrying out daily cell functions, Replicating DNA (making copies of DNA)
-
which answer choice correctly identifies the carbon molecules? a = carb…
A. A = carbohydrate; B = lipid; C = nucleic acid; D = protein (assuming the multiple - choice option with the correct identification of carbohydrate and lipid as described above i…
-
3. analyze cause and effect what was one effect of the use of vernacula…
Increased literacy rates among the general public.
-
all the biological macromolecules contain hydrogen, oxygen and carbon. …
Carbohydrate molecules contain only carbon, hydrogen and oxygen atoms, whereas nucleic acid molecules also have a nitrogen base and phosphate group.
-
haley pays a monthly fee of $20 for her cell phone and then pays 5 cent…
Domain: $m\geq0$; Range: $C(m)\geq20$
-
mitosis results in genetically ______ cells being produced identical di…
identical
-
the picture below shows a group of water striders walking on the surfac…
Hydrogen bonds provide cohesion of the water molecules, enabling the bugs to stay afloat.
-
when does your body use mitosis? select all that are correct. growth to…
Growth
-
question 12 what will happen to the rate of enzyme activity if substrat…
Initially increase, then remain constant
-
a scientist has four petri dishes of different sizes. each dish contain…
Dish C and Dish D have approximately the same population density.
-
question 1-1 which of the following lists macromolecules that both have…
proteins and nucleic acids
-
5. what modern debate surrounds machiavellis work the prince? mark only…
Whether his political theories are relevant to modern governance, Whether he describes an effective leader or a tyrant
-
what is the variable in this picture? how often the plants are watered …
How often the plants are watered
-
this is a model to help students understand the process of photosynthes…
D. it is incomplete and does not show all reactants and products.
-
which statement correctly describes the diagram? a the products of phot…
B. The products of respiration can be used by plants for photosynthesis.
-
westward expansion crash course qs name: amir abernathy date: 9/16/25 d…
1. In the early exploration and settlement of the American West. 2. a. Individualism b. Democracy c. Restlessness 3. A land of opportunity to start anew, gain land, and seek fortu…
-
look carefully at the model. plants take in and release carbon dioxide.…
C. respiration
-
this 19th - century black opera singer was known as \the black swan,\ p…
1. B. Elizabeth Taylor Greenfield 2. C. Binary form
-
what was one of the most significant contributions of hittite society? …
D. The development of ironworking techniques that spread throughout the ancient Near East
-
question 14 the relative growth rate of psychrophilic, mesophilic and t…
45°C
-
question 1-10 which is a biotic factor that might affect the life of a …
D. bacterial population in the water
-
24 multiple choice 2 points occurs in yeast and produces carbon dioxide…
24. B. alcohol fermentation 25. A. 2 molecules of CO₂ is produced, C. 3 NADH are produced, D. 1 ATP is produced
-
cells are only found in plants and not in animals. cells are responsibl…
- First question: Cells are responsible for performing vital functions in all living organisms. - Second question: alcohol fermentation - Third question: 2 molecules of CO₂ is pro…
-
question 55 the period when traders introduced new crops is called what…
- Question 55: The Muslim Agricultural Revolution - Question 56: No drawing of people allowed - Question 57: Calligraphy
-
read the excerpt from abraham lincolns first inaugural address. this co…
his reference to every citizen's rights
-
21 multiple choice 2 points how many atps are produced in the krebs cyc…
21. B. 1 22. D. the inner membrane of the mitochondria 23. B. Cells are responsible for performing vital functions in all living organisms.
-
18 multiple choice 2 points what did matthias schleiden propose in 1838…
18. The cell is the basic structural and functional unit of life 19. a phospholipid bilayer 20. cell wall
-
the by - products of cellular respiration include a energy and oxygen. …
C. carbon dioxide and water
-
question 1 - 6 which example best illustrates the relationship between …
D. light availability determining the growth rate of plants
-
surface activities pose more risk in world locations with the highest s…
Recreationists that are at the top of the water mostly
-
15 multiple choice 2 points the ____________ is the site of photosynthe…
15. D. chloroplast 16. A. glycolysis 17. B. lactic acid
-
bell ringer - vocab. sentences, english ii read through each sentence. …
1. Anomaly 2. Flee 3. Apathy 4. Envious 5. Mocked
-
following his diagnosis, trentons doctor explains that his condition is…
diabetes
-
question 1 - 9 which example best illustrates the relationship between …
Water currents carrying rocks downstream
-
12 multiple choice 2 points what is the function of flagella in prokary…
12. D. movement 13. D. interaction between cells 14. D. cell to cell recognition
-
the doctor says that lydias baby has a disorder caused by one single ge…
cystic fibrosis
-
question 1 - 8 which abiotic factor distinguishes freshwater systems fr…
salinity
-
9 multiple choice 2 points how many net atps are produced during glycol…
9. B. 2 10. D. All of the above 11. C. cellulose
-
question 1 - 7 which of the following abiotic factors could affect the …
droughts, floods, and heat waves
-
6 multiple choice 2 points which is true about phospholipids? the heads…
6. the heads are hydrophilic 7. olive oil 8. chemiosmosis
-
years after the lava from an erupting volcano destroyed an area, lichen…
pioneer species, intermediate species, and climax community
-
3 multiple choice 2 points in which stage of aerobic respiration can up…
3. D. Electron Transport Chain 4. B. protein synthesis 5. B. To transfer high - energy electrons
-
after the revolutionary war, the articles of confederation gave most of…
B. the state governments