Sovi.AI - AI Math Tutor

Scan to solve math questions

QUESTION IMAGE

consider the following nucleotide sequence, which represents an mrna mo…

Question

consider the following nucleotide sequence, which represents an mrna molecule:
5 -cgauguaucgauuauagaaaaaa- 3
use the following codon table to translate the mrna molecule into its corresponding polypeptide sequence, beginning at the first available start codon.
figure 1. codon table showing the amino acid encoded by each possible mrna codon.
which of the following represents the correct translation of the mrna molecule, starting at the first available start codon?
choose 1 answer:
a met - tyr - arg - leu - stop - lys - lys
b lys - lys - arg - tyr
c arg - cys - ile - asp - tyr - arg - lys
d met - tyr - arg - leu

Explanation:

Step1: Identify the start codon

The start codon is AUG (codes for Met). In the mRNA sequence \( 5' - \text{CGAUGUAUCGAUUAUAGAAAAAA} - 3' \), the first AUG is at positions 3 - 5 (counting from 1: C(1), G(2), A(3), U(4), G(5), U(6)... Wait, let's write the sequence with positions:
1: C, 2: G, 3: A, 4: U, 5: G, 6: U, 7: A, 8: U, 9: C, 10: G, 11: A, 12: U, 13: U, 14: A, 15: U, 16: A, 17: G, 18: A, 19: A, 20: A, 21: A, 22: A. Wait, no, the mRNA is \( 5' - \text{CGAUGUAUCGAUUAUAGAAAAAA} - 3' \), so let's split into codons starting from the first AUG. The sequence is C G A U G U A U C G A U U A U A G A A A A A A. Wait, no, let's group into codons (3 nucleotides each) starting from the first AUG. The AUG is at positions 4 - 6? Wait, the mRNA is written as \( 5' - \text{CGAUGUAUCGAUUAUAGAAAAAA} - 3' \), so the nucleotides are: C, G, A, U, G, U, A, U, C, G, A, U, U, A, U, A, G, A, A, A, A, A. Now, find the first AUG: A is at position 3? No, position 4 is U, 5 is G, 6 is U? Wait, no, let's write the sequence as a string: "CGAUGUAUCGAUUAUAGAAAAAA". Let's index from 0:
0: C, 1: G, 2: A, 3: U, 4: G, 5: U, 6: A, 7: U, 8: C, 9: G, 10: A, 11: U, 12: U, 13: A, 14: U, 15: A, 16: G, 17: A, 18: A, 19: A, 20: A, 21: A. Now, the start codon AUG: A is at index 2? No, AUG is A (index 2), U (index 3), G (index 4)? Wait, no, AUG is three nucleotides: A, U, G. Wait, index 2: A, index 3: U, index 4: G? Yes! So AUG is at indices 2,3,4 (nucleotides A, U, G). So the first codon after start is AUG (Met), then the next codons:

After AUG (indices 2 - 4), the next codon is U (index 5), A (index 6), U (index 7): UAU (Tyr, from codon table: UAU is Tyr). Then next codon: C (index 8), G (index 9), A (index 10): CGA (Arg, from codon table: CGA is Arg). Then next codon: U (index 11), U (index 12), A (index 13): UUA (Leu, from codon table: UUA is Leu). Then next codon: U (index 14), A (index 15), G (index 16): UAG (Stop, from codon table: UAG is Stop). Wait, but after Stop, we stop translation. Wait, but let's check the options. Wait, the options:

Option A: Met - Tyr - Arg - Leu - Stop - Lys - Lys. But after Stop, translation stops, so why Lys - Lys? Wait, maybe I made a mistake in grouping. Wait, let's re - group the mRNA sequence correctly. The mRNA is \( 5' - \text{CGAUGUAUCGAUUAUAGAAAAAA} - 3' \). Let's write the sequence as:

Nucleotides: C, G, A, U, G, U, A, U, C, G, A, U, U, A, U, A, G, A, A, A, A, A.

Now, find the start codon (AUG). Let's look for AUG: A is at position 3? No, position 1: C, 2: G, 3: A, 4: U, 5: G, 6: U, 7: A, 8: U, 9: C, 10: G, 11: A, 12: U, 13: U, 14: A, 15: U, 16: A, 17: G, 18: A, 19: A, 20: A, 21: A. Wait, AUG is A (position 3? No, position 3 is A, position 4 is U, position 5 is G? Yes! So AUG is positions 3,4,5? Wait, position 3: A, 4: U, 5: G. Yes, AUG. So the first codon is AUG (Met), then next codon: U (position 6), A (position 7), U (position 8): UAU (Tyr). Next codon: C (position 9), G (position 10), A (position 11): CGA (Arg). Next codon: U (position 12), U (position 13), A (position 14): UUA (Leu). Next codon: U (position 15), A (position 16), G (position 17): UAG (Stop). But then after UAG (Stop), the remaining nucleotides are AAAAAA, which are AAA (Lys) repeated. But translation stops at Stop codon, so why is there Lys - Lys? Wait, maybe I mis - grouped the codons. Wait, let's check the mRNA sequence again: \( 5' - \text{CGAUGUAUCGAUUAUAGAAAAAA} - 3' \). Let's split into codons starting from the first AUG:

AUG (Met) - UAU (Tyr) - CGA (Arg) - UUA (Leu) - UAG (Stop) - AAA (Lys) - AAA (Lys). Wait, but UAG is a Stop codon, but maybe th…

Answer:

D. Met - Tyr - Arg - Leu