Question

codes for protein no function regulatory function in cell acattacggatcgactaccggatgatcatccagtt the label above each section of the model of dna shows that segments role within a particular cell. which of the following best describes the function of dna within a cell? (1 point) all segments of dna code for proteins within a cell. each segment of dna has the same regulatory function within a cell. every segment of dna must have a function within a cell. the segments of dna can have different functions within a cell.

Explanation:

• Analyze each option:
• Option 1: The model shows some DNA segments have "no function" and "regulatory function", not all code for proteins.
• Option 2: The model shows different functions (coding for protein, no function, regulatory), so not same regulatory function.
• Option 3: The model has a "no function" segment, so not every segment has a function.
• Option 4: The model clearly shows segments with different functions (codes for protein, no function, regulatory function in cell).

Answer:

The segments of DNA can have different functions within a cell.